EMAIL THIS PAGE TO A FRIEND

CENPC

centromere protein C

46 Gene Product Result for
Synonyms: CENP-C CENPC1 MIF2 hcp-4
Gene ID:
Human(1060) Summary: Centromere protein C 1 is a centromere autoantigen and a component of the inner kinetochore plate. The protein is required for maintaining proper kinetochore size and a timely transition to anaphase. A putative pseudogene exists on chromosome 12. [provided by RefSeq, Jul 2008]
Rat(305270) centromere protein C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001812 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001812 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001812 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041181 MISSION® esiRNA esiRNA human CENPC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001812 Rosetta Predictions human pricing
NM_001004098 Rosetta Predictions rat pricing
XM_579124 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077718 predicted 762
2 SASI_Hs01_00077719 predicted 502
3 SASI_Hs01_00077720 predicted 352
4 SASI_Hs01_00077722 predicted 2762
5 SASI_Hs01_00077723 predicted 2073
6 SASI_Hs01_00077724 predicted 2693
7 SASI_Hs02_00332593 predicted 2438
8 SASI_Hs02_00332594 predicted 1704
9 SASI_Hs01_00077726 predicted 1267
10 SASI_Hs01_00077727 predicted 2739
11 SASI_Hs01_00077721 predicted 2329
12 SASI_Hs01_00077725 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004098 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078194 predicted 726
2 SASI_Rn01_00078195 predicted 2098
3 SASI_Rn01_00078196 predicted 1666
4 SASI_Rn01_00078197 predicted 2014
5 SASI_Rn01_00078198 predicted 592
6 SASI_Rn01_00078199 predicted 2138
7 SASI_Rn01_00078200 predicted 668
8 SASI_Rn01_00078201 predicted 2219
9 SASI_Rn01_00078202 predicted 1018
10 SASI_Rn02_00198152 predicted 2630
11 SASI_Rn01_00078193 predicted 2492
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579124 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00159905 predicted 2493
2 SASI_Rn01_00159906 predicted 2101
3 SASI_Rn01_00159907 predicted 2000
4 SASI_Rn01_00159908 predicted 1671
5 SASI_Rn01_00159909 predicted 1718
6 SASI_Rn01_00159910 predicted 2019
7 SASI_Rn01_00159911 predicted 2149
8 SASI_Rn01_00159912 predicted 2334
9 SASI_Rn01_00159913 predicted 2234
10 SASI_Rn01_00159914 predicted 2641
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001812
VALIDATED
CENPC MISSION shRNA Bacterial Glycerol Stock
centromere protein C
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001812.1-2476s1c1
Sequence:CCGGCCAGACACAATATCGTCTAAACTCGAGTTTAGACGATATTGTGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001812.1-1663s1c1
Sequence:CCGGGAGTCCAAGAACAAACTTGTACTCGAGTACAAGTTTGTTCTTGGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_001812.1-1043s1c1
Sequence:CCGGCGAAGTTGATAGAGGATGAATCTCGAGATTCATCCTCTATCAACTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001812.1-1505s1c1
Sequence:CCGGCCCAAGACGAATTTCAAAGAACTCGAGTTCTTTGAAATTCGTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001812.1-2900s1c1
Sequence:CCGGCGTTCTATGTTCCTTCAGGTACTCGAGTACCTGAAGGAACATAGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001812.1-1039s1c1
Sequence:CCGGGATACGAAGTTGATAGAGGATCTCGAGATCCTCTATCAACTTCGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001812.1-1033s1c1
Sequence:CCGGCCCGATGATACGAAGTTGATACTCGAGTATCAACTTCGTATCATCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001812.1-2712s1c1
Sequence:CCGGGCATGGTGAGTTGAAGGTATACTCGAGTATACCTTCAACTCACCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001812.1-2373s1c1
Sequence:CCGGGACCAAGAGAACACGTTTGAACTCGAGTTCAAACGTGTTCTCTTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001812.1-226s1c1
Sequence:CCGGCGTGACATTAACACAGAGCAACTCGAGTTGCTCTGTGTTAATGTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001812.2-2468s21c1
Sequence:CCGGCATCAGGAGGATTCGTGATTACTCGAGTAATCACGAATCCTCCTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001812.2-3066s21c1
Sequence:CCGGCAGTTTGTATAGTTGGAATATCTCGAGATATTCCAACTATACAAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001812.2-2235s21c1
Sequence:CCGGTGGACCTTCCAGGCTCAATAACTCGAGTTATTGAGCCTGGAAGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001812.2-1525s21c1
Sequence:CCGGCATATTACCCAAGACGAATTTCTCGAGAAATTCGTCTTGGGTAATATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001812.2-1050s21c1
Sequence:CCGGTTCGTGTCCTCCCGATGATACCTCGAGGTATCATCGGGAGGACACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001812
VALIDATED
CENPC MISSION shRNA shRNA Plasmid DNA
centromere protein C
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001812.1-2476s1c1
Sequence:CCGGCCAGACACAATATCGTCTAAACTCGAGTTTAGACGATATTGTGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001812.1-1663s1c1
Sequence:CCGGGAGTCCAAGAACAAACTTGTACTCGAGTACAAGTTTGTTCTTGGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_001812.1-1043s1c1
Sequence:CCGGCGAAGTTGATAGAGGATGAATCTCGAGATTCATCCTCTATCAACTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001812.1-1505s1c1
Sequence:CCGGCCCAAGACGAATTTCAAAGAACTCGAGTTCTTTGAAATTCGTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001812.1-2900s1c1
Sequence:CCGGCGTTCTATGTTCCTTCAGGTACTCGAGTACCTGAAGGAACATAGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001812.1-1039s1c1
Sequence:CCGGGATACGAAGTTGATAGAGGATCTCGAGATCCTCTATCAACTTCGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001812.1-1033s1c1
Sequence:CCGGCCCGATGATACGAAGTTGATACTCGAGTATCAACTTCGTATCATCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001812.1-2712s1c1
Sequence:CCGGGCATGGTGAGTTGAAGGTATACTCGAGTATACCTTCAACTCACCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001812.1-2373s1c1
Sequence:CCGGGACCAAGAGAACACGTTTGAACTCGAGTTCAAACGTGTTCTCTTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001812.1-226s1c1
Sequence:CCGGCGTGACATTAACACAGAGCAACTCGAGTTGCTCTGTGTTAATGTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001812.2-2468s21c1
Sequence:CCGGCATCAGGAGGATTCGTGATTACTCGAGTAATCACGAATCCTCCTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001812.2-3066s21c1
Sequence:CCGGCAGTTTGTATAGTTGGAATATCTCGAGATATTCCAACTATACAAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001812.2-2235s21c1
Sequence:CCGGTGGACCTTCCAGGCTCAATAACTCGAGTTATTGAGCCTGGAAGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001812.2-1525s21c1
Sequence:CCGGCATATTACCCAAGACGAATTTCTCGAGAAATTCGTCTTGGGTAATATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001812.2-1050s21c1
Sequence:CCGGTTCGTGTCCTCCCGATGATACCTCGAGGTATCATCGGGAGGACACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001812
VALIDATED
CENPC MISSION shRNA Lentiviral Transduction Particles
centromere protein C
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001812.1-2476s1c1
Sequence:CCGGCCAGACACAATATCGTCTAAACTCGAGTTTAGACGATATTGTGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001812.1-1663s1c1
Sequence:CCGGGAGTCCAAGAACAAACTTGTACTCGAGTACAAGTTTGTTCTTGGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_001812.1-1043s1c1
Sequence:CCGGCGAAGTTGATAGAGGATGAATCTCGAGATTCATCCTCTATCAACTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001812.1-1505s1c1
Sequence:CCGGCCCAAGACGAATTTCAAAGAACTCGAGTTCTTTGAAATTCGTCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001812.1-2900s1c1
Sequence:CCGGCGTTCTATGTTCCTTCAGGTACTCGAGTACCTGAAGGAACATAGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001812.1-1039s1c1
Sequence:CCGGGATACGAAGTTGATAGAGGATCTCGAGATCCTCTATCAACTTCGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001812.1-1033s1c1
Sequence:CCGGCCCGATGATACGAAGTTGATACTCGAGTATCAACTTCGTATCATCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001812.1-2712s1c1
Sequence:CCGGGCATGGTGAGTTGAAGGTATACTCGAGTATACCTTCAACTCACCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001812.1-2373s1c1
Sequence:CCGGGACCAAGAGAACACGTTTGAACTCGAGTTCAAACGTGTTCTCTTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001812.1-226s1c1
Sequence:CCGGCGTGACATTAACACAGAGCAACTCGAGTTGCTCTGTGTTAATGTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001812.2-2468s21c1
Sequence:CCGGCATCAGGAGGATTCGTGATTACTCGAGTAATCACGAATCCTCCTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001812.2-3066s21c1
Sequence:CCGGCAGTTTGTATAGTTGGAATATCTCGAGATATTCCAACTATACAAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001812.2-2235s21c1
Sequence:CCGGTGGACCTTCCAGGCTCAATAACTCGAGTTATTGAGCCTGGAAGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001812.2-1525s21c1
Sequence:CCGGCATATTACCCAAGACGAATTTCTCGAGAAATTCGTCTTGGGTAATATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001812.2-1050s21c1
Sequence:CCGGTTCGTGTCCTCCCGATGATACCTCGAGGTATCATCGGGAGGACACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)