EMAIL THIS PAGE TO A FRIEND

CENPQ

centromere protein Q

51 Gene Product Result for
Synonyms: C6orf139 CENP-Q
UniProtKB ID: Q7L2Z9, A8KAF1, Q6IN61, Q9NVS5
Gene ID:
Human(55166) Summary: CENPQ is a subunit of a CENPH (MIM 605607)-CENPI (MIM 300065)-associated centromeric complex that targets CENPA (MIM 117139) to centromeres and is required for proper kinetochore function and mitotic progression (Okada et al., 2006 [PubMed 16622420]
Mouse(83815) centromere protein Q
Rat(363198) centromere protein Q
naked mole-rat(101719775) centromere protein Q
domestic guinea pig(100717734) centromere protein Q
sheep(101123157) centromere protein Q
chicken(422048) centromere protein Q
dog(474931) centromere protein Q
cow(616874) centromere protein Q
domestic cat(101092609) centromere protein Q
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018132 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018132 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018132 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031863 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031863 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031863 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018132 Rosetta Predictions human pricing
NM_001014215 Rosetta Predictions rat pricing
NM_031863 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245502 predicted 1342
2 SASI_Hs01_00245503 predicted 1218
3 SASI_Hs01_00245504 predicted 1245
4 SASI_Hs01_00245506 predicted 592
5 SASI_Hs01_00245507 predicted 608
6 SASI_Hs01_00245508 predicted 1161
7 SASI_Hs02_00351349 predicted 1344
8 SASI_Hs02_00351350 predicted 1214
9 SASI_Hs01_00245509 predicted 1171
10 SASI_Hs01_00245510 predicted 1150
11 SASI_Hs01_00245505 predicted 1161
12 SASI_Hs01_00245511 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014215 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058218 predicted 951
2 SASI_Rn01_00058219 predicted 695
3 SASI_Rn02_00201749 predicted 279
4 SASI_Rn01_00058220 predicted 705
5 SASI_Rn01_00058222 predicted 788
6 SASI_Rn01_00058223 predicted 588
7 SASI_Rn01_00058224 predicted 266
8 SASI_Rn01_00058225 predicted 972
9 SASI_Rn01_00058226 predicted 429
10 SASI_Rn01_00058227 predicted 803
11 SASI_Rn01_00058221 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194549 predicted 1023
2 SASI_Mm01_00194551 predicted 1043
3 SASI_Mm01_00194552 predicted 253
4 SASI_Mm01_00194553 predicted 1045
5 SASI_Mm01_00194554 predicted 529
6 SASI_Mm01_00194555 predicted 317
7 SASI_Mm01_00194556 predicted 450
8 SASI_Mm01_00194557 predicted 818
9 SASI_Mm01_00194558 predicted 927
10 SASI_Mm02_00337179 predicted 524
11 SASI_Mm01_00194550 predicted 797
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018132
CENPQ MISSION shRNA Bacterial Glycerol Stock
centromere protein Q
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018132.3-809s21c1
Sequence:CCGGGGACTTGGATATTCTTCATAACTCGAGTTATGAAGAATATCCAAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018132.3-1032s21c1
Sequence:CCGGGTCTTTGTAGTTCTATCATTACTCGAGTAATGATAGAACTACAAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018132.3-1157s21c1
Sequence:CCGGGAATTGCCTTAAGGATCTAATCTCGAGATTAGATCCTTAAGGCAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018132.3-984s21c1
Sequence:CCGGTAAGGCTTCTGCAGGATTTATCTCGAGATAAATCCTGCAGAAGCCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018132.3-598s21c1
Sequence:CCGGAGTTAATGACTGGGAATATTCCTCGAGGAATATTCCCAGTCATTAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168468    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018132.3-1084s1c1
Sequence:CCGGGCAGTTGCCAAATCTAGGAAACTCGAGTTTCCTAGATTTGGCAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018132.3-329s1c1
Sequence:CCGGCAGAGACCATTTGCAAACTATCTCGAGATAGTTTGCAAATGGTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018132.3-342s1c1
Sequence:CCGGCAAACTATGATGGAATCAGTACTCGAGTACTGATTCCATCATAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167266    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018132.3-1189s1c1
Sequence:CCGGCCTGAATGGAACTCATTTATTCTCGAGAATAAATGAGTTCCATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018132.3-595s1c1
Sequence:CCGGCAGAGTTAATGACTGGGAATACTCGAGTATTCCCAGTCATTAACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018132.3-436s1c1
Sequence:CCGGGATTGCTACAACAGTGTGAAACTCGAGTTTCACACTGTTGTAGCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018132.3-525s1c1
Sequence:CCGGGCACGAGACAAAGCTAATGAACTCGAGTTCATTAGCTTTGTCTCGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018132.3-842s1c1
Sequence:CCGGGAAGAGCATGTCAACCTTCATCTCGAGATGAAGGTTGACATGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018132
CENPQ MISSION shRNA shRNA Plasmid DNA
centromere protein Q
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018132.3-809s21c1
Sequence:CCGGGGACTTGGATATTCTTCATAACTCGAGTTATGAAGAATATCCAAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018132.3-1032s21c1
Sequence:CCGGGTCTTTGTAGTTCTATCATTACTCGAGTAATGATAGAACTACAAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018132.3-1157s21c1
Sequence:CCGGGAATTGCCTTAAGGATCTAATCTCGAGATTAGATCCTTAAGGCAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018132.3-984s21c1
Sequence:CCGGTAAGGCTTCTGCAGGATTTATCTCGAGATAAATCCTGCAGAAGCCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018132.3-598s21c1
Sequence:CCGGAGTTAATGACTGGGAATATTCCTCGAGGAATATTCCCAGTCATTAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168468    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018132.3-1084s1c1
Sequence:CCGGGCAGTTGCCAAATCTAGGAAACTCGAGTTTCCTAGATTTGGCAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018132.3-329s1c1
Sequence:CCGGCAGAGACCATTTGCAAACTATCTCGAGATAGTTTGCAAATGGTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018132.3-342s1c1
Sequence:CCGGCAAACTATGATGGAATCAGTACTCGAGTACTGATTCCATCATAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167266    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018132.3-1189s1c1
Sequence:CCGGCCTGAATGGAACTCATTTATTCTCGAGAATAAATGAGTTCCATTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018132.3-595s1c1
Sequence:CCGGCAGAGTTAATGACTGGGAATACTCGAGTATTCCCAGTCATTAACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018132.3-436s1c1
Sequence:CCGGGATTGCTACAACAGTGTGAAACTCGAGTTTCACACTGTTGTAGCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018132.3-525s1c1
Sequence:CCGGGCACGAGACAAAGCTAATGAACTCGAGTTCATTAGCTTTGTCTCGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018132.3-842s1c1
Sequence:CCGGGAAGAGCATGTCAACCTTCATCTCGAGATGAAGGTTGACATGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018132
CENPQ MISSION shRNA Lentiviral Transduction Particles
centromere protein Q
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018132.3-809s21c1
Sequence:CCGGGGACTTGGATATTCTTCATAACTCGAGTTATGAAGAATATCCAAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018132.3-1032s21c1
Sequence:CCGGGTCTTTGTAGTTCTATCATTACTCGAGTAATGATAGAACTACAAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018132.3-1157s21c1
Sequence:CCGGGAATTGCCTTAAGGATCTAATCTCGAGATTAGATCCTTAAGGCAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018132.3-984s21c1
Sequence:CCGGTAAGGCTTCTGCAGGATTTATCTCGAGATAAATCCTGCAGAAGCCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018132.3-598s21c1
Sequence:CCGGAGTTAATGACTGGGAATATTCCTCGAGGAATATTCCCAGTCATTAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168468    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018132.3-1084s1c1
Sequence:CCGGGCAGTTGCCAAATCTAGGAAACTCGAGTTTCCTAGATTTGGCAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018132.3-329s1c1
Sequence:CCGGCAGAGACCATTTGCAAACTATCTCGAGATAGTTTGCAAATGGTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018132.3-342s1c1
Sequence:CCGGCAAACTATGATGGAATCAGTACTCGAGTACTGATTCCATCATAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167266    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018132.3-1189s1c1
Sequence:CCGGCCTGAATGGAACTCATTTATTCTCGAGAATAAATGAGTTCCATTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018132.3-595s1c1
Sequence:CCGGCAGAGTTAATGACTGGGAATACTCGAGTATTCCCAGTCATTAACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018132.3-436s1c1
Sequence:CCGGGATTGCTACAACAGTGTGAAACTCGAGTTTCACACTGTTGTAGCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018132.3-525s1c1
Sequence:CCGGGCACGAGACAAAGCTAATGAACTCGAGTTCATTAGCTTTGTCTCGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018132.3-842s1c1
Sequence:CCGGGAAGAGCATGTCAACCTTCATCTCGAGATGAAGGTTGACATGCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031863
VALIDATED
CENPQ MISSION shRNA Bacterial Glycerol Stock
centromere protein Q
Mouse
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031863.3-713s1c1
Sequence:CCGGGAGTCAATGACTGAGAGTATTCTCGAGAATACTCTCAGTCATTGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031863.3-587s1c1
Sequence:CCGGCCAAGAAAGTTGAACTATTTACTCGAGTAAATAGTTCAACTTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216089    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031863.3-1238s1c1
Sequence:CCGGCAACTTAACTGGAGATCTTTCCTCGAGGAAAGATCTCCAGTTAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031863.3-894s1c1
Sequence:CCGGCACTAATTCCAAACCAGAATGCTCGAGCATTCTGGTTTGGAATTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216192    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031863.3-1133s1c1
Sequence:CCGGCACTTATTCTTTCTCCCATTTCTCGAGAAATGGGAGAAAGAATAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_031863.3-1033s21c1
Sequence:CCGGTTAAGCCGTGTTCCATATTAACTCGAGTTAATATGGAACACGGCTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031863.3-272s21c1
Sequence:CCGGGCCAATAAGGAAGCGGATTTGCTCGAGCAAATCCGCTTCCTTATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_031863.3-714s21c1
Sequence:CCGGAGTCAATGACTGAGAGTATTCCTCGAGGAATACTCTCAGTCATTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031863.3-788s21c1
Sequence:CCGGCAGGAGGTGAAACAGGTATTTCTCGAGAAATACCTGTTTCACCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031863.3-370s21c1
Sequence:CCGGAGCAACGTATGTTCATCTAAACTCGAGTTTAGATGAACATACGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197952    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031863.1-1038s1c1
Sequence:CCGGGCCGTGTTCCATATTAACTTACTCGAGTAAGTTAATATGGAACACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031863.1-921s1c1
Sequence:CCGGCTGAAGGACTTGGATGTTCTTCTCGAGAAGAACATCCAAGTCCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031863.1-339s1c1
Sequence:CCGGGCAAAGCATCTGTCCTCTAAACTCGAGTTTAGAGGACAGATGCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031863.1-355s1c1
Sequence:CCGGCTAAAGTAACAGGACAAGCAACTCGAGTTGCTTGTCCTGTTACTTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031863.1-989s1c1
Sequence:CCGGCTATAAGAAACTTGACTCCTACTCGAGTAGGAGTCAAGTTTCTTATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031863.1-438s1c1
Sequence:CCGGCCAAAGGATACTGAAGAGTATCTCGAGATACTCTTCAGTATCCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031863
VALIDATED
CENPQ MISSION shRNA shRNA Plasmid DNA
centromere protein Q
Mouse
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031863.3-713s1c1
Sequence:CCGGGAGTCAATGACTGAGAGTATTCTCGAGAATACTCTCAGTCATTGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031863.3-587s1c1
Sequence:CCGGCCAAGAAAGTTGAACTATTTACTCGAGTAAATAGTTCAACTTTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216089    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031863.3-1238s1c1
Sequence:CCGGCAACTTAACTGGAGATCTTTCCTCGAGGAAAGATCTCCAGTTAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031863.3-894s1c1
Sequence:CCGGCACTAATTCCAAACCAGAATGCTCGAGCATTCTGGTTTGGAATTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216192    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031863.3-1133s1c1
Sequence:CCGGCACTTATTCTTTCTCCCATTTCTCGAGAAATGGGAGAAAGAATAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_031863.3-1033s21c1
Sequence:CCGGTTAAGCCGTGTTCCATATTAACTCGAGTTAATATGGAACACGGCTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031863.3-272s21c1
Sequence:CCGGGCCAATAAGGAAGCGGATTTGCTCGAGCAAATCCGCTTCCTTATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_031863.3-714s21c1
Sequence:CCGGAGTCAATGACTGAGAGTATTCCTCGAGGAATACTCTCAGTCATTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031863.3-788s21c1
Sequence:CCGGCAGGAGGTGAAACAGGTATTTCTCGAGAAATACCTGTTTCACCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031863.3-370s21c1
Sequence:CCGGAGCAACGTATGTTCATCTAAACTCGAGTTTAGATGAACATACGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197952    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031863.1-1038s1c1
Sequence:CCGGGCCGTGTTCCATATTAACTTACTCGAGTAAGTTAATATGGAACACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031863.1-921s1c1
Sequence:CCGGCTGAAGGACTTGGATGTTCTTCTCGAGAAGAACATCCAAGTCCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031863.1-339s1c1
Sequence:CCGGGCAAAGCATCTGTCCTCTAAACTCGAGTTTAGAGGACAGATGCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031863.1-355s1c1
Sequence:CCGGCTAAAGTAACAGGACAAGCAACTCGAGTTGCTTGTCCTGTTACTTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031863.1-989s1c1
Sequence:CCGGCTATAAGAAACTTGACTCCTACTCGAGTAGGAGTCAAGTTTCTTATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031863.1-438s1c1
Sequence:CCGGCCAAAGGATACTGAAGAGTATCTCGAGATACTCTTCAGTATCCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031863
VALIDATED
CENPQ MISSION shRNA Lentiviral Transduction Particles
centromere protein Q
Mouse
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031863.3-713s1c1
Sequence:CCGGGAGTCAATGACTGAGAGTATTCTCGAGAATACTCTCAGTCATTGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031863.3-587s1c1
Sequence:CCGGCCAAGAAAGTTGAACTATTTACTCGAGTAAATAGTTCAACTTTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216089    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031863.3-1238s1c1
Sequence:CCGGCAACTTAACTGGAGATCTTTCCTCGAGGAAAGATCTCCAGTTAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031863.3-894s1c1
Sequence:CCGGCACTAATTCCAAACCAGAATGCTCGAGCATTCTGGTTTGGAATTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216192    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031863.3-1133s1c1
Sequence:CCGGCACTTATTCTTTCTCCCATTTCTCGAGAAATGGGAGAAAGAATAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_031863.3-1033s21c1
Sequence:CCGGTTAAGCCGTGTTCCATATTAACTCGAGTTAATATGGAACACGGCTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031863.3-272s21c1
Sequence:CCGGGCCAATAAGGAAGCGGATTTGCTCGAGCAAATCCGCTTCCTTATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_031863.3-714s21c1
Sequence:CCGGAGTCAATGACTGAGAGTATTCCTCGAGGAATACTCTCAGTCATTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031863.3-788s21c1
Sequence:CCGGCAGGAGGTGAAACAGGTATTTCTCGAGAAATACCTGTTTCACCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031863.3-370s21c1
Sequence:CCGGAGCAACGTATGTTCATCTAAACTCGAGTTTAGATGAACATACGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197952    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031863.1-1038s1c1
Sequence:CCGGGCCGTGTTCCATATTAACTTACTCGAGTAAGTTAATATGGAACACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031863.1-921s1c1
Sequence:CCGGCTGAAGGACTTGGATGTTCTTCTCGAGAAGAACATCCAAGTCCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031863.1-339s1c1
Sequence:CCGGGCAAAGCATCTGTCCTCTAAACTCGAGTTTAGAGGACAGATGCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031863.1-355s1c1
Sequence:CCGGCTAAAGTAACAGGACAAGCAACTCGAGTTGCTTGTCCTGTTACTTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031863.1-989s1c1
Sequence:CCGGCTATAAGAAACTTGACTCCTACTCGAGTAGGAGTCAAGTTTCTTATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031863.1-438s1c1
Sequence:CCGGCCAAAGGATACTGAAGAGTATCTCGAGATACTCTTCAGTATCCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)