EMAIL THIS PAGE TO A FRIEND

CEP72

centrosomal protein 72kDa

59 Gene Product Result for
UniProtKB ID: Q9P209, B4DR26, Q9BV03, Q9BWM3, Q9NVR4
Gene ID:
Human(55722) Summary: The product of this gene is a member of the leucine-rich-repeat (LRR) superfamily of proteins. The protein is localized to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. [provided by RefSeq, Jul 2008]
Mouse(74470) centrosomal protein 72
Rat(308064) centrosomal protein 72
domestic guinea pig(100734676) centrosomal protein 72kDa
naked mole-rat(101725378) centrosomal protein 72kDa
sheep(101109828) centrosomal protein 72kDa
Zebrafish(553488) centrosomal protein 72
Horse(100057712) centrosomal protein 72kDa
cow(617312) centrosomal protein 72kDa
domestic cat(101082215) centrosomal protein 72kDa
dog(478632) centrosomal protein 72kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018140 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018140 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018140 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028959 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028959 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028959 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041081 MISSION® esiRNA esiRNA human CEP72 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018140 Rosetta Predictions human pricing
XM_001056326 Rosetta Predictions rat pricing
XM_217737 Rosetta Predictions rat pricing
NM_028959 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351368 predicted 220
2 SASI_Hs01_00076420 predicted 1606
3 SASI_Hs01_00076421 predicted 761
4 SASI_Hs01_00076422 predicted 1419
5 SASI_Hs01_00076423 predicted 1508
6 SASI_Hs01_00076424 predicted 2057
7 SASI_Hs02_00351369 predicted 236
8 SASI_Hs01_00076425 predicted 1071
9 SASI_Hs01_00076426 predicted 344
10 SASI_Hs01_00076427 predicted 1636
11 SASI_Hs01_00076419 predicted 2017
12 SASI_Hs01_00076428 predicted 2004
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056326 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282920 predicted 559
2 SASI_Rn02_00282921 predicted 1595
3 SASI_Rn02_00282922 predicted 275
4 SASI_Rn02_00282923 predicted 199
5 SASI_Rn02_00282924 predicted 1199
6 SASI_Rn02_00282925 predicted 508
7 SASI_Rn02_00282926 predicted 1045
8 SASI_Rn02_00282927 predicted 1571
9 SASI_Rn02_00282928 predicted 518
10 SASI_Rn02_00282929 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217737 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377347 predicted 344
2 SASI_Rn02_00377348 predicted 378
3 SASI_Rn02_00377349 predicted 632
4 SASI_Rn02_00377350 predicted 277
5 SASI_Rn02_00377351 predicted 199
6 SASI_Rn02_00377352 predicted 235
7 SASI_Rn02_00377353 predicted 522
8 SASI_Rn02_00377354 predicted 366
9 SASI_Rn02_00377355 predicted 427
10 SASI_Rn02_00377356 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028959 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104841 predicted 1998
2 SASI_Mm01_00104842 predicted 1410
3 SASI_Mm01_00104843 predicted 432
4 SASI_Mm01_00104844 predicted 1432
5 SASI_Mm01_00104846 predicted 1304
6 SASI_Mm01_00104847 predicted 1194
7 SASI_Mm01_00104849 predicted 1559
8 SASI_Mm01_00104850 predicted 1036
9 SASI_Mm02_00334686 predicted 449
10 SASI_Mm02_00334687 predicted 1688
11 SASI_Mm01_00104845 predicted 1635
12 SASI_Mm01_00104848 predicted 1565
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018140
VALIDATED
CEP72 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 72kDa
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018140.2-504s1c1
Sequence:CCGGGCTTCTTTGAAAGAGGGCAGACTCGAGTCTGCCCTCTTTCAAAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018140.2-2007s1c1
Sequence:CCGGGTCTGCACCTTTGTACTTCTTCTCGAGAAGAAGTACAAAGGTGCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018140.2-96s1c1
Sequence:CCGGGAGCTTCAGTCATTGTCTATTCTCGAGAATAGACAATGACTGAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018140.2-1548s1c1
Sequence:CCGGCTGGATGATTTGAGACAACATCTCGAGATGTTGTCTCAAATCATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018140.2-106s1c1
Sequence:CCGGCATTGTCTATTCCTGGAACTTCTCGAGAAGTTCCAGGAATAGACAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018140.2-254s1c1
Sequence:CCGGCAATCTCTACTACAACTGCATCTCGAGATGCAGTTGTAGTAGAGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018140.2-698s1c1
Sequence:CCGGCCAAGAATCCAGACATCTGTTCTCGAGAACAGATGTCTGGATTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018140.2-1026s1c1
Sequence:CCGGGTTGGAAGATTCCAGACGTTTCTCGAGAAACGTCTGGAATCTTCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018140.2-1673s1c1
Sequence:CCGGCGCTGGACTTCAAACAAGTGTCTCGAGACACTTGTTTGAAGTCCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018140.2-939s1c1
Sequence:CCGGGCCTCTTCTCAGAAGTTGGATCTCGAGATCCAACTTCTGAGAAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018140.2-223s1c1
Sequence:CCGGGCATTCAGTACCTGACTGCATCTCGAGATGCAGTCAGGTACTGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018140.3-157s21c1
Sequence:CCGGGAGCTTCAGTCATTGTCTATTCTCGAGAATAGACAATGACTGAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_018140.3-1644s21c1
Sequence:CCGGGGAAGAGAACAGTAGGTTAAACTCGAGTTTAACCTACTGTTCTCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018140.3-1705s21c1
Sequence:CCGGGACACTGCAGCCACGTTAAATCTCGAGATTTAACGTGGCTGCAGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018140.3-353s21c1
Sequence:CCGGTGTTTCGGCTCCACGCCTTAACTCGAGTTAAGGCGTGGAGCCGAAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018140.3-2253s21c1
Sequence:CCGGTTGAGACAAACTGACTATTAACTCGAGTTAATAGTCAGTTTGTCTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018140
VALIDATED
CEP72 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 72kDa
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018140.2-504s1c1
Sequence:CCGGGCTTCTTTGAAAGAGGGCAGACTCGAGTCTGCCCTCTTTCAAAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018140.2-2007s1c1
Sequence:CCGGGTCTGCACCTTTGTACTTCTTCTCGAGAAGAAGTACAAAGGTGCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018140.2-96s1c1
Sequence:CCGGGAGCTTCAGTCATTGTCTATTCTCGAGAATAGACAATGACTGAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018140.2-1548s1c1
Sequence:CCGGCTGGATGATTTGAGACAACATCTCGAGATGTTGTCTCAAATCATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018140.2-106s1c1
Sequence:CCGGCATTGTCTATTCCTGGAACTTCTCGAGAAGTTCCAGGAATAGACAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018140.2-254s1c1
Sequence:CCGGCAATCTCTACTACAACTGCATCTCGAGATGCAGTTGTAGTAGAGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018140.2-698s1c1
Sequence:CCGGCCAAGAATCCAGACATCTGTTCTCGAGAACAGATGTCTGGATTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018140.2-1026s1c1
Sequence:CCGGGTTGGAAGATTCCAGACGTTTCTCGAGAAACGTCTGGAATCTTCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018140.2-1673s1c1
Sequence:CCGGCGCTGGACTTCAAACAAGTGTCTCGAGACACTTGTTTGAAGTCCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018140.2-939s1c1
Sequence:CCGGGCCTCTTCTCAGAAGTTGGATCTCGAGATCCAACTTCTGAGAAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018140.2-223s1c1
Sequence:CCGGGCATTCAGTACCTGACTGCATCTCGAGATGCAGTCAGGTACTGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018140.3-157s21c1
Sequence:CCGGGAGCTTCAGTCATTGTCTATTCTCGAGAATAGACAATGACTGAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_018140.3-1644s21c1
Sequence:CCGGGGAAGAGAACAGTAGGTTAAACTCGAGTTTAACCTACTGTTCTCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018140.3-1705s21c1
Sequence:CCGGGACACTGCAGCCACGTTAAATCTCGAGATTTAACGTGGCTGCAGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018140.3-353s21c1
Sequence:CCGGTGTTTCGGCTCCACGCCTTAACTCGAGTTAAGGCGTGGAGCCGAAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018140.3-2253s21c1
Sequence:CCGGTTGAGACAAACTGACTATTAACTCGAGTTAATAGTCAGTTTGTCTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018140
VALIDATED
CEP72 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 72kDa
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018140.2-504s1c1
Sequence:CCGGGCTTCTTTGAAAGAGGGCAGACTCGAGTCTGCCCTCTTTCAAAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018140.2-2007s1c1
Sequence:CCGGGTCTGCACCTTTGTACTTCTTCTCGAGAAGAAGTACAAAGGTGCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018140.2-96s1c1
Sequence:CCGGGAGCTTCAGTCATTGTCTATTCTCGAGAATAGACAATGACTGAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018140.2-1548s1c1
Sequence:CCGGCTGGATGATTTGAGACAACATCTCGAGATGTTGTCTCAAATCATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018140.2-106s1c1
Sequence:CCGGCATTGTCTATTCCTGGAACTTCTCGAGAAGTTCCAGGAATAGACAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018140.2-254s1c1
Sequence:CCGGCAATCTCTACTACAACTGCATCTCGAGATGCAGTTGTAGTAGAGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018140.2-698s1c1
Sequence:CCGGCCAAGAATCCAGACATCTGTTCTCGAGAACAGATGTCTGGATTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018140.2-1026s1c1
Sequence:CCGGGTTGGAAGATTCCAGACGTTTCTCGAGAAACGTCTGGAATCTTCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018140.2-1673s1c1
Sequence:CCGGCGCTGGACTTCAAACAAGTGTCTCGAGACACTTGTTTGAAGTCCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018140.2-939s1c1
Sequence:CCGGGCCTCTTCTCAGAAGTTGGATCTCGAGATCCAACTTCTGAGAAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018140.2-223s1c1
Sequence:CCGGGCATTCAGTACCTGACTGCATCTCGAGATGCAGTCAGGTACTGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018140.3-157s21c1
Sequence:CCGGGAGCTTCAGTCATTGTCTATTCTCGAGAATAGACAATGACTGAAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_018140.3-1644s21c1
Sequence:CCGGGGAAGAGAACAGTAGGTTAAACTCGAGTTTAACCTACTGTTCTCTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018140.3-1705s21c1
Sequence:CCGGGACACTGCAGCCACGTTAAATCTCGAGATTTAACGTGGCTGCAGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018140.3-353s21c1
Sequence:CCGGTGTTTCGGCTCCACGCCTTAACTCGAGTTAAGGCGTGGAGCCGAAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018140.3-2253s21c1
Sequence:CCGGTTGAGACAAACTGACTATTAACTCGAGTTAATAGTCAGTTTGTCTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028959
CEP72 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 72kDa
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028959.1-1477s1c1
Sequence:CCGGGCTGAGCAACAGCAACAGTATCTCGAGATACTGTTGCTGTTGCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028959.1-673s1c1
Sequence:CCGGGAACATGAAGCTGACCTCCATCTCGAGATGGAGGTCAGCTTCATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028959.3-1524s21c1
Sequence:CCGGATGACAGCAGAGCTCAATAATCTCGAGATTATTGAGCTCTGCTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028959.3-1592s21c1
Sequence:CCGGGGAAGAGAATAGCCACTTAAACTCGAGTTTAAGTGGCTATTCTCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028959.3-217s21c1
Sequence:CCGGTGGTTAGCCTTGAGGGTATACCTCGAGGTATACCCTCAAGGCTAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028959.3-99s21c1
Sequence:CCGGCTGGCTGAACTTCGATCTTTACTCGAGTAAAGATCGAAGTTCAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028959.3-286s1c1
Sequence:CCGGCTTCATTAGCAGAAGTATTTACTCGAGTAAATACTTCTGCTAATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028959.3-2011s21c1
Sequence:CCGGGTACCTGGGCATGCATCTATCCTCGAGGATAGATGCATGCCCAGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028959
CEP72 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 72kDa
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028959.1-1477s1c1
Sequence:CCGGGCTGAGCAACAGCAACAGTATCTCGAGATACTGTTGCTGTTGCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028959.1-673s1c1
Sequence:CCGGGAACATGAAGCTGACCTCCATCTCGAGATGGAGGTCAGCTTCATGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028959.3-1524s21c1
Sequence:CCGGATGACAGCAGAGCTCAATAATCTCGAGATTATTGAGCTCTGCTGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028959.3-1592s21c1
Sequence:CCGGGGAAGAGAATAGCCACTTAAACTCGAGTTTAAGTGGCTATTCTCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028959.3-217s21c1
Sequence:CCGGTGGTTAGCCTTGAGGGTATACCTCGAGGTATACCCTCAAGGCTAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028959.3-99s21c1
Sequence:CCGGCTGGCTGAACTTCGATCTTTACTCGAGTAAAGATCGAAGTTCAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028959.3-286s1c1
Sequence:CCGGCTTCATTAGCAGAAGTATTTACTCGAGTAAATACTTCTGCTAATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028959.3-2011s21c1
Sequence:CCGGGTACCTGGGCATGCATCTATCCTCGAGGATAGATGCATGCCCAGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028959
CEP72 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 72kDa
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028959.1-1477s1c1
Sequence:CCGGGCTGAGCAACAGCAACAGTATCTCGAGATACTGTTGCTGTTGCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028959.1-673s1c1
Sequence:CCGGGAACATGAAGCTGACCTCCATCTCGAGATGGAGGTCAGCTTCATGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028959.3-1524s21c1
Sequence:CCGGATGACAGCAGAGCTCAATAATCTCGAGATTATTGAGCTCTGCTGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028959.3-1592s21c1
Sequence:CCGGGGAAGAGAATAGCCACTTAAACTCGAGTTTAAGTGGCTATTCTCTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028959.3-217s21c1
Sequence:CCGGTGGTTAGCCTTGAGGGTATACCTCGAGGTATACCCTCAAGGCTAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028959.3-99s21c1
Sequence:CCGGCTGGCTGAACTTCGATCTTTACTCGAGTAAAGATCGAAGTTCAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028959.3-286s1c1
Sequence:CCGGCTTCATTAGCAGAAGTATTTACTCGAGTAAATACTTCTGCTAATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028959.3-2011s21c1
Sequence:CCGGGTACCTGGGCATGCATCTATCCTCGAGGATAGATGCATGCCCAGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)