EMAIL THIS PAGE TO A FRIEND

CEP76

centrosomal protein 76kDa

104 Gene Product Result for
Synonyms: C18orf9 HsT1705
UniProtKB ID: Q8TAP6, B0YJB2, B4DXG5, B4DZW1, Q658N5, Q9H9U7
Gene ID:
Human(79959) Summary: This gene encodes a centrosomal protein which regulates centriole amplification by limiting centriole duplication to once per cell cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Mouse(225659) centrosomal protein 76
Rat(291540) centrosomal protein 76
Zebrafish(564926) centrosomal protein 76
cow(515285) centrosomal protein 76kDa
chicken(421039) centrosomal protein 76kDa
Horse(100050324) centrosomal protein 76kDa
dog(480214) centrosomal protein 76kDa
sheep(101109664) centrosomal protein 76kDa
Domestic Rabbit(100344732) centrosomal protein 76kDa
naked mole-rat(101724448) centrosomal protein 76kDa
domestic guinea pig(100732359) centrosomal protein 76kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024899 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024899 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024899 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081073 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081073 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081073 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024899 Rosetta Predictions human pricing
XM_001067027 Rosetta Predictions rat pricing
XM_214549 Rosetta Predictions rat pricing
NM_001081073 Rosetta Predictions mouse pricing
XM_129027 Rosetta Predictions mouse pricing
XM_902049 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140357 predicted 751
2 SASI_Hs01_00140358 predicted 765
3 SASI_Hs01_00140360 predicted 979
4 SASI_Hs01_00140361 predicted 1456
5 SASI_Hs01_00140362 predicted 2056
6 SASI_Hs01_00140363 predicted 1977
7 SASI_Hs01_00140364 predicted 953
8 SASI_Hs01_00140365 predicted 1327
9 SASI_Hs01_00140366 predicted 1110
10 SASI_Hs02_00357497 predicted 1885
11 SASI_Hs01_00140359 predicted 1559
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319614 predicted 2569
2 SASI_Rn02_00319615 predicted 1159
3 SASI_Rn02_00319616 predicted 2274
4 SASI_Rn02_00319617 predicted 2577
5 SASI_Rn02_00319618 predicted 1617
6 SASI_Rn02_00319619 predicted 1193
7 SASI_Rn02_00319620 predicted 2035
8 SASI_Rn02_00319621 predicted 2004
9 SASI_Rn02_00319622 predicted 1846
10 SASI_Rn02_00319623 predicted 2174
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214549 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375405 predicted 2569
2 SASI_Rn02_00375406 predicted 1155
3 SASI_Rn02_00375407 predicted 2272
4 SASI_Rn02_00375408 predicted 2583
5 SASI_Rn02_00375409 predicted 1616
6 SASI_Rn02_00375410 predicted 1199
7 SASI_Rn02_00375411 predicted 2030
8 SASI_Rn02_00375412 predicted 2008
9 SASI_Rn02_00375413 predicted 1843
10 SASI_Rn02_00375414 predicted 2178
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081073 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294911 predicted 1514
2 SASI_Mm02_00294912 predicted 2124
3 SASI_Mm02_00294913 predicted 2137
4 SASI_Mm02_00294914 predicted 2127
5 SASI_Mm02_00294915 predicted 753
6 SASI_Mm02_00294916 predicted 770
7 SASI_Mm02_00294917 predicted 662
8 SASI_Mm02_00294918 predicted 1842
9 SASI_Mm02_00294919 predicted 1735
10 SASI_Mm02_00294920 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129027 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273781 predicted 1524
2 SASI_Mm01_00273782 predicted 2135
3 SASI_Mm01_00273783 predicted 2138
4 SASI_Mm01_00273784 predicted 2138
5 SASI_Mm01_00273785 predicted 757
6 SASI_Mm01_00273786 predicted 714
7 SASI_Mm01_00273787 predicted 771
8 SASI_Mm01_00273788 predicted 668
9 SASI_Mm01_00273789 predicted 1846
10 SASI_Mm01_00273790 predicted 1737
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902049 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236765 predicted 1305
2 SASI_Mm01_00236766 predicted 1906
3 SASI_Mm01_00236767 predicted 1917
4 SASI_Mm01_00236768 predicted 1916
5 SASI_Mm01_00236769 predicted 1924
6 SASI_Mm01_00236770 predicted 538
7 SASI_Mm01_00236771 predicted 491
8 SASI_Mm01_00236772 predicted 560
9 SASI_Mm01_00236773 predicted 1634
10 SASI_Mm01_00236774 predicted 1416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024899
CEP76 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 76kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024899.2-769s21c1
Sequence:CCGGACGACTTTAGTAGCATCATATCTCGAGATATGATGCTACTAAAGTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024899.2-2110s1c1
Sequence:CCGGGCTTGTAAATATCGCTCGGTACTCGAGTACCGAGCGATATTTACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024899.2-683s1c1
Sequence:CCGGGAACTAGAATGGCTGATTCAACTCGAGTTGAATCAGCCATTCTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024899.2-1150s1c1
Sequence:CCGGCTTCTTGATACTCCAAGGCAACTCGAGTTGCCTTGGAGTATCAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024899.2-425s21c1
Sequence:CCGGTTGATAGACAATCGACATTAACTCGAGTTAATGTCGATTGTCTATCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024899.2-984s21c1
Sequence:CCGGTGCAGAGAAAGAGCGATTATTCTCGAGAATAATCGCTCTTTCTCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024899.2-1929s1c1
Sequence:CCGGCACATTTAAAGGGTTCCCAATCTCGAGATTGGGAACCCTTTAAATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024899.2-1576s1c1
Sequence:CCGGGCAGTAGAAACCTGTGTATTTCTCGAGAAATACACAGGTTTCTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024899.2-2648s1c1
Sequence:CCGGGATATTTGAGACTGTCCAGAACTCGAGTTCTGGACAGTCTCAAATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024899.2-2468s1c1
Sequence:CCGGGAGATGTTTGTCTAAGGGTTTCTCGAGAAACCCTTAGACAAACATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024899
CEP76 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 76kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024899.2-769s21c1
Sequence:CCGGACGACTTTAGTAGCATCATATCTCGAGATATGATGCTACTAAAGTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024899.2-2110s1c1
Sequence:CCGGGCTTGTAAATATCGCTCGGTACTCGAGTACCGAGCGATATTTACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024899.2-683s1c1
Sequence:CCGGGAACTAGAATGGCTGATTCAACTCGAGTTGAATCAGCCATTCTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024899.2-1150s1c1
Sequence:CCGGCTTCTTGATACTCCAAGGCAACTCGAGTTGCCTTGGAGTATCAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024899.2-425s21c1
Sequence:CCGGTTGATAGACAATCGACATTAACTCGAGTTAATGTCGATTGTCTATCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024899.2-984s21c1
Sequence:CCGGTGCAGAGAAAGAGCGATTATTCTCGAGAATAATCGCTCTTTCTCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024899.2-1929s1c1
Sequence:CCGGCACATTTAAAGGGTTCCCAATCTCGAGATTGGGAACCCTTTAAATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024899.2-1576s1c1
Sequence:CCGGGCAGTAGAAACCTGTGTATTTCTCGAGAAATACACAGGTTTCTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024899.2-2648s1c1
Sequence:CCGGGATATTTGAGACTGTCCAGAACTCGAGTTCTGGACAGTCTCAAATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024899.2-2468s1c1
Sequence:CCGGGAGATGTTTGTCTAAGGGTTTCTCGAGAAACCCTTAGACAAACATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024899
CEP76 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 76kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024899.2-769s21c1
Sequence:CCGGACGACTTTAGTAGCATCATATCTCGAGATATGATGCTACTAAAGTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024899.2-2110s1c1
Sequence:CCGGGCTTGTAAATATCGCTCGGTACTCGAGTACCGAGCGATATTTACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024899.2-683s1c1
Sequence:CCGGGAACTAGAATGGCTGATTCAACTCGAGTTGAATCAGCCATTCTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024899.2-1150s1c1
Sequence:CCGGCTTCTTGATACTCCAAGGCAACTCGAGTTGCCTTGGAGTATCAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024899.2-425s21c1
Sequence:CCGGTTGATAGACAATCGACATTAACTCGAGTTAATGTCGATTGTCTATCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024899.2-984s21c1
Sequence:CCGGTGCAGAGAAAGAGCGATTATTCTCGAGAATAATCGCTCTTTCTCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024899.2-1929s1c1
Sequence:CCGGCACATTTAAAGGGTTCCCAATCTCGAGATTGGGAACCCTTTAAATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024899.2-1576s1c1
Sequence:CCGGGCAGTAGAAACCTGTGTATTTCTCGAGAAATACACAGGTTTCTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024899.2-2648s1c1
Sequence:CCGGGATATTTGAGACTGTCCAGAACTCGAGTTCTGGACAGTCTCAAATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024899.2-2468s1c1
Sequence:CCGGGAGATGTTTGTCTAAGGGTTTCTCGAGAAACCCTTAGACAAACATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081073
CEP76 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 76kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081073.1-990s21c1
Sequence:CCGGTGCAGAGAAAGAGCGATTATTCTCGAGAATAATCGCTCTTTCTCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081073.1-2250s21c1
Sequence:CCGGCATAGATCTGACTGGTAATATCTCGAGATATTACCAGTCAGATCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081073.1-1093s21c1
Sequence:CCGGCAGGATGAGAATGGGATAAATCTCGAGATTTATCCCATTCTCATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081073.1-732s21c1
Sequence:CCGGTCCAATTCACATGGTACTAATCTCGAGATTAGTACCATGTGAATTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081073.1-430s21c1
Sequence:CCGGTTTGATAAGCAGTCAACATTACTCGAGTAATGTTGACTGCTTATCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081073
CEP76 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 76kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081073.1-990s21c1
Sequence:CCGGTGCAGAGAAAGAGCGATTATTCTCGAGAATAATCGCTCTTTCTCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081073.1-2250s21c1
Sequence:CCGGCATAGATCTGACTGGTAATATCTCGAGATATTACCAGTCAGATCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081073.1-1093s21c1
Sequence:CCGGCAGGATGAGAATGGGATAAATCTCGAGATTTATCCCATTCTCATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081073.1-732s21c1
Sequence:CCGGTCCAATTCACATGGTACTAATCTCGAGATTAGTACCATGTGAATTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081073.1-430s21c1
Sequence:CCGGTTTGATAAGCAGTCAACATTACTCGAGTAATGTTGACTGCTTATCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081073
CEP76 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 76kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081073.1-990s21c1
Sequence:CCGGTGCAGAGAAAGAGCGATTATTCTCGAGAATAATCGCTCTTTCTCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081073.1-2250s21c1
Sequence:CCGGCATAGATCTGACTGGTAATATCTCGAGATATTACCAGTCAGATCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081073.1-1093s21c1
Sequence:CCGGCAGGATGAGAATGGGATAAATCTCGAGATTTATCCCATTCTCATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081073.1-732s21c1
Sequence:CCGGTCCAATTCACATGGTACTAATCTCGAGATTAGTACCATGTGAATTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081073.1-430s21c1
Sequence:CCGGTTTGATAAGCAGTCAACATTACTCGAGTAATGTTGACTGCTTATCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)