EMAIL THIS PAGE TO A FRIEND

CEP78

centrosomal protein 78kDa

137 Gene Product Result for
Synonyms: C9orf81 IP63
Gene ID:
Mouse(208518) centrosomal protein 78
Rat(60347) centrosomal protein 78
domestic guinea pig(100715425) centrosomal protein 78kDa
naked mole-rat(101716112) centrosomal protein 78kDa
sheep(101112035) centrosomal protein 78kDa
Domestic Rabbit(100348618) centrosomal protein 78kDa
Zebrafish(564741) centrosomal protein 78
cow(537926) centrosomal protein 78kDa
domestic cat(101094961) centrosomal protein 78kDa
dog(607243) centrosomal protein 78kDa
chicken(431612) centrosomal protein 78kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198019 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198019 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198019 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_095991 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_095991 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_095991 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098802 Rosetta Predictions human pricing
NM_032171 Rosetta Predictions human pricing
XM_095991 Rosetta Predictions human pricing
XM_927454 Rosetta Predictions human pricing
XM_932077 Rosetta Predictions human pricing
XM_932084 Rosetta Predictions human pricing
XM_932091 Rosetta Predictions human pricing
XM_932103 Rosetta Predictions human pricing
XM_932109 Rosetta Predictions human pricing
NM_021741 Rosetta Predictions rat pricing
NM_198019 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319919 predicted 784
2 SASI_Hs02_00319920 predicted 811
3 SASI_Hs02_00319921 predicted 945
4 SASI_Hs02_00319922 predicted 2482
5 SASI_Hs02_00319923 predicted 1030
6 SASI_Hs02_00319924 predicted 1122
7 SASI_Hs02_00319925 predicted 579
8 SASI_Hs02_00319926 predicted 1074
9 SASI_Hs02_00319927 predicted 824
10 SASI_Hs02_00319928 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359424 predicted 778
2 SASI_Hs02_00359425 predicted 812
3 SASI_Hs02_00359426 predicted 941
4 SASI_Hs02_00359427 predicted 2436
5 SASI_Hs02_00359428 predicted 1029
6 SASI_Hs02_00359429 predicted 1124
7 SASI_Hs02_00359430 predicted 573
8 SASI_Hs02_00359431 predicted 1081
9 SASI_Hs02_00359432 predicted 826
10 SASI_Hs02_00359433 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_095991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289075 predicted 774
2 SASI_Hs01_00289076 predicted 803
3 SASI_Hs01_00289077 predicted 930
4 SASI_Hs01_00289078 predicted 1903
5 SASI_Hs01_00289079 predicted 1315
6 SASI_Hs01_00289080 predicted 1664
7 SASI_Hs01_00289081 predicted 1030
8 SASI_Hs01_00289082 predicted 568
9 SASI_Hs01_00289083 predicted 2028
10 SASI_Hs01_00289084 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288690 predicted 1964
2 SASI_Hs01_00288691 predicted 1965
3 SASI_Hs01_00288692 predicted 2108
4 SASI_Hs01_00288693 predicted 2036
5 SASI_Hs01_00288694 predicted 2032
6 SASI_Hs01_00288695 predicted 2078
7 SASI_Hs01_00288696 predicted 2037
8 SASI_Hs01_00288697 predicted 2078
9 SASI_Hs01_00288698 predicted 1967
10 SASI_Hs01_00288699 predicted 2030
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249953 predicted 267
2 SASI_Hs01_00249954 predicted 271
3 SASI_Hs01_00249955 predicted 273
4 SASI_Hs01_00249956 predicted 240
5 SASI_Hs01_00249957 predicted 256
6 SASI_Hs01_00249958 predicted 252
7 SASI_Hs01_00249959 predicted 272
8 SASI_Hs01_00249960 predicted 274
9 SASI_Hs01_00249961 predicted 264
10 SASI_Hs01_00249962 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932084 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300757 predicted 279
2 SASI_Hs01_00300758 predicted 431
3 SASI_Hs01_00300759 predicted 285
4 SASI_Hs01_00300760 predicted 288
5 SASI_Hs01_00300761 predicted 260
6 SASI_Hs01_00300762 predicted 275
7 SASI_Hs01_00300763 predicted 267
8 SASI_Hs01_00300764 predicted 429
9 SASI_Hs01_00300765 predicted 363
10 SASI_Hs01_00300766 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251165 predicted 587
2 SASI_Hs01_00251166 predicted 242
3 SASI_Hs01_00251167 predicted 641
4 SASI_Hs01_00251168 predicted 593
5 SASI_Hs01_00251169 predicted 212
6 SASI_Hs01_00251170 predicted 493
7 SASI_Hs01_00251171 predicted 636
8 SASI_Hs01_00251172 predicted 573
9 SASI_Hs01_00251173 predicted 413
10 SASI_Hs01_00251174 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276244 predicted 333
2 SASI_Hs01_00276245 predicted 292
3 SASI_Hs01_00276246 predicted 278
4 SASI_Hs01_00276247 predicted 342
5 SASI_Hs01_00276248 predicted 479
6 SASI_Hs01_00276249 predicted 275
7 SASI_Hs01_00276250 predicted 400
8 SASI_Hs01_00276251 predicted 449
9 SASI_Hs01_00276252 predicted 278
10 SASI_Hs01_00276253 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291689 predicted 777
2 SASI_Hs01_00291690 predicted 809
3 SASI_Hs01_00291691 predicted 940
4 SASI_Hs01_00291692 predicted 1902
5 SASI_Hs01_00291693 predicted 1315
6 SASI_Hs01_00291694 predicted 1659
7 SASI_Hs01_00291695 predicted 1026
8 SASI_Hs01_00291696 predicted 576
9 SASI_Hs01_00291697 predicted 2027
10 SASI_Hs01_00291698 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021741 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262764 predicted 277
2 SASI_Rn01_00083803 predicted 1062
3 SASI_Rn01_00083806 predicted 893
4 SASI_Rn02_00262765 predicted 557
5 SASI_Rn02_00262766 predicted 306
6 SASI_Rn01_00083811 predicted 1137
7 SASI_Rn02_00262767 predicted 2175
8 SASI_Rn02_00262768 predicted 1952
9 SASI_Rn02_00262769 predicted 1407
10 SASI_Rn02_00262770 predicted 1541
11 SASI_Rn01_00083802 predicted 1239
12 SASI_Rn01_00083804 predicted 1282
13 SASI_Rn01_00083805 predicted 1052
14 SASI_Rn01_00083807 predicted 1095
15 SASI_Rn01_00083808 predicted 505
16 SASI_Rn01_00083809 predicted 482
17 SASI_Rn01_00083810 predicted 1356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198019 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136153 predicted 2283
2 SASI_Mm01_00136154 predicted 432
3 SASI_Mm01_00136155 predicted 1176
4 SASI_Mm02_00350730 predicted 646
5 SASI_Mm01_00136157 predicted 1826
6 SASI_Mm01_00136158 predicted 516
7 SASI_Mm01_00136159 predicted 420
8 SASI_Mm01_00136160 predicted 1757
9 SASI_Mm01_00136161 predicted 389
10 SASI_Mm02_00350731 predicted 1679
11 SASI_Mm01_00136156 predicted 1603
12 SASI_Mm01_00136162 predicted 666
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198019
CEP78 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 78kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198019.2-378s1c1
Sequence:CCGGGTGCTGATACACACCGAATTTCTCGAGAAATTCGGTGTGTATCAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198019.2-1178s1c1
Sequence:CCGGGCAACCATTAGAATTGGTTTACTCGAGTAAACCAATTCTAATGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198019.2-2418s1c1
Sequence:CCGGGTGATACTCTTGGATCTGATTCTCGAGAATCAGATCCAAGAGTATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198019.2-1210s1c1
Sequence:CCGGGCCTTCGAGTAATGGGAGAAACTCGAGTTTCTCCCATTACTCGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198019.2-1101s1c1
Sequence:CCGGCATCATCAAAGGAACCGTCTACTCGAGTAGACGGTTCCTTTGATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198019.2-2291s1c1
Sequence:CCGGCTGCTTAATGAGCCAATTAAACTCGAGTTTAATTGGCTCATTAAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198019.2-2366s1c1
Sequence:CCGGGTCTCATCTAAGACTATCAAACTCGAGTTTGATAGTCTTAGATGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198019.2-1772s1c1
Sequence:CCGGGCTGGCATAGATCAGTCAGATCTCGAGATCTGACTGATCTATGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198019.2-497s1c1
Sequence:CCGGCTGGAGCTAAATGGGCTGATTCTCGAGAATCAGCCCATTTAGCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198019.2-1885s1c1
Sequence:CCGGACAGACTGCCACCGGACAAATCTCGAGATTTGTCCGGTGGCAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198019
CEP78 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 78kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198019.2-378s1c1
Sequence:CCGGGTGCTGATACACACCGAATTTCTCGAGAAATTCGGTGTGTATCAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198019.2-1178s1c1
Sequence:CCGGGCAACCATTAGAATTGGTTTACTCGAGTAAACCAATTCTAATGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198019.2-2418s1c1
Sequence:CCGGGTGATACTCTTGGATCTGATTCTCGAGAATCAGATCCAAGAGTATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198019.2-1210s1c1
Sequence:CCGGGCCTTCGAGTAATGGGAGAAACTCGAGTTTCTCCCATTACTCGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198019.2-1101s1c1
Sequence:CCGGCATCATCAAAGGAACCGTCTACTCGAGTAGACGGTTCCTTTGATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198019.2-2291s1c1
Sequence:CCGGCTGCTTAATGAGCCAATTAAACTCGAGTTTAATTGGCTCATTAAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198019.2-2366s1c1
Sequence:CCGGGTCTCATCTAAGACTATCAAACTCGAGTTTGATAGTCTTAGATGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198019.2-1772s1c1
Sequence:CCGGGCTGGCATAGATCAGTCAGATCTCGAGATCTGACTGATCTATGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198019.2-497s1c1
Sequence:CCGGCTGGAGCTAAATGGGCTGATTCTCGAGAATCAGCCCATTTAGCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198019.2-1885s1c1
Sequence:CCGGACAGACTGCCACCGGACAAATCTCGAGATTTGTCCGGTGGCAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198019
CEP78 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 78kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198019.2-378s1c1
Sequence:CCGGGTGCTGATACACACCGAATTTCTCGAGAAATTCGGTGTGTATCAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198019.2-1178s1c1
Sequence:CCGGGCAACCATTAGAATTGGTTTACTCGAGTAAACCAATTCTAATGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198019.2-2418s1c1
Sequence:CCGGGTGATACTCTTGGATCTGATTCTCGAGAATCAGATCCAAGAGTATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198019.2-1210s1c1
Sequence:CCGGGCCTTCGAGTAATGGGAGAAACTCGAGTTTCTCCCATTACTCGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198019.2-1101s1c1
Sequence:CCGGCATCATCAAAGGAACCGTCTACTCGAGTAGACGGTTCCTTTGATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198019.2-2291s1c1
Sequence:CCGGCTGCTTAATGAGCCAATTAAACTCGAGTTTAATTGGCTCATTAAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198019.2-2366s1c1
Sequence:CCGGGTCTCATCTAAGACTATCAAACTCGAGTTTGATAGTCTTAGATGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198019.2-1772s1c1
Sequence:CCGGGCTGGCATAGATCAGTCAGATCTCGAGATCTGACTGATCTATGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198019.2-497s1c1
Sequence:CCGGCTGGAGCTAAATGGGCTGATTCTCGAGAATCAGCCCATTTAGCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198019.2-1885s1c1
Sequence:CCGGACAGACTGCCACCGGACAAATCTCGAGATTTGTCCGGTGGCAGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_095991
VALIDATED
CEP78 MISSION shRNA Bacterial Glycerol Stock
centrosomal protein 78kDa
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000072685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_095991.7-545s1c1
Sequence:CCGGCCTGCGATAAGATACAAAGATCTCGAGATCTTTGTATCTTATCGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_095991.7-1057s1c1
Sequence:CCGGCCTCACCAATGAAGGAGCAAACTCGAGTTTGCTCCTTCATTGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_095991.7-1904s1c1
Sequence:CCGGGCTGGGATAGATCAGTCAGATCTCGAGATCTGACTGATCTATCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_095991.7-2448s1c1
Sequence:CCGGGCAAAGAAACTAGGGAAACTACTCGAGTAGTTTCCCTAGTTTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_095991
VALIDATED
CEP78 MISSION shRNA shRNA Plasmid DNA
centrosomal protein 78kDa
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000072685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_095991.7-545s1c1
Sequence:CCGGCCTGCGATAAGATACAAAGATCTCGAGATCTTTGTATCTTATCGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_095991.7-1057s1c1
Sequence:CCGGCCTCACCAATGAAGGAGCAAACTCGAGTTTGCTCCTTCATTGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_095991.7-1904s1c1
Sequence:CCGGGCTGGGATAGATCAGTCAGATCTCGAGATCTGACTGATCTATCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_095991.7-2448s1c1
Sequence:CCGGGCAAAGAAACTAGGGAAACTACTCGAGTAGTTTCCCTAGTTTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_095991
VALIDATED
CEP78 MISSION shRNA Lentiviral Transduction Particles
centrosomal protein 78kDa
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000072685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_095991.7-545s1c1
Sequence:CCGGCCTGCGATAAGATACAAAGATCTCGAGATCTTTGTATCTTATCGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_095991.7-1057s1c1
Sequence:CCGGCCTCACCAATGAAGGAGCAAACTCGAGTTTGCTCCTTCATTGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_095991.7-1904s1c1
Sequence:CCGGGCTGGGATAGATCAGTCAGATCTCGAGATCTGACTGATCTATCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_095991.7-2448s1c1
Sequence:CCGGGCAAAGAAACTAGGGAAACTACTCGAGTAGTTTCCCTAGTTTCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)