EMAIL THIS PAGE TO A FRIEND

CFC1

cripto, FRL-1, cryptic family 1

60 Gene Product Result for
Synonyms: CFC1B CRYPTIC DTGA2 HTX2
Species: Human CFC1(55997), Mouse Cfc1(12627), Rat Cfc1(501121), domestic guinea pig Cfc1(101787576)
UniProtKB ID: P0CG37, B2RCY0, B9EJD3, Q53T05, Q9GZR3
Gene ID:
Human(55997) Summary: This gene encodes a member of the epidermal growth factor (EGF)- Cripto, Frl-1, and Cryptic (CFC) family, which are involved in signalling during embryonic development. Proteins in this family share a variant EGF-like motif, a conserved cysteine-rich domain, and a C-terminal hydrophobic region. The protein encoded by this gene is necessary for patterning the left-right embryonic axis. Mutations in this gene are associated with defects in organ development, including autosomal visceral heterotaxy and congenital heart disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Mouse(12627) cripto, FRL-1, cryptic family 1
Rat(501121) cripto, FRL-1, cryptic family 1
domestic guinea pig(101787576) cripto, FRL-1, cryptic family 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1398 Human Cryptic ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032545 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032545 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032545 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007685 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007685 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007685 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032545 Rosetta Predictions human pricing
NM_001109304 Rosetta Predictions rat pricing
NM_007685 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123609 predicted 235
2 SASI_Hs01_00123611 predicted 264
3 SASI_Hs01_00123613 predicted 333
4 SASI_Hs01_00123614 predicted 552
5 SASI_Hs02_00360048 predicted 265
6 SASI_Hs02_00360049 predicted 227
7 SASI_Hs02_00360050 predicted 234
8 SASI_Hs01_00123618 predicted 573
9 SASI_Hs02_00360051 predicted 361
10 SASI_Hs02_00360052 predicted 306
11 SASI_Hs01_00123610 predicted 360
12 SASI_Hs01_00123612 predicted 254
13 SASI_Hs01_00123615 predicted 452
14 SASI_Hs01_00123616 predicted 370
15 SASI_Hs01_00123617 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109304 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247104 predicted 629
2 SASI_Rn02_00247105 predicted 725
3 SASI_Rn02_00247106 predicted 321
4 SASI_Rn02_00247107 predicted 337
5 SASI_Rn02_00247108 predicted 643
6 SASI_Rn02_00247109 predicted 638
7 SASI_Rn02_00247110 predicted 389
8 SASI_Rn02_00247111 predicted 389
9 SASI_Rn02_00247112 predicted 484
10 SASI_Rn02_00247113 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007685 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162437 predicted 264
2 SASI_Mm01_00162438 predicted 683
3 SASI_Mm01_00162439 predicted 596
4 SASI_Mm01_00162440 predicted 359
5 SASI_Mm01_00162441 predicted 533
6 SASI_Mm01_00162442 predicted 554
7 SASI_Mm01_00162443 predicted 512
8 SASI_Mm01_00162444 predicted 491
9 SASI_Mm01_00162445 predicted 510
10 SASI_Mm01_00162446 predicted 427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032545
CFC1 MISSION shRNA Bacterial Glycerol Stock
cripto, FRL-1, cryptic family 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032545.2-252s1c1
Sequence:CCGGGTTTACGGTCAGTTTGGCATTCTCGAGAATGCCAAACTGACCGTAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032545.2-273s1c1
Sequence:CCGGACAGATCATCAATTTGGGAAACTCGAGTTTCCCAAATTGATGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032545.2-687s1c1
Sequence:CCGGCCGCTGTGACCCGAAAGACTTCTCGAGAAGTCTTTCGGGTCACAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032545.2-375s1c1
Sequence:CCGGCAACTGGACCTCCAGTCATTTCTCGAGAAATGACTGGAGGTCCAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032545.2-305s1c1
Sequence:CCGGGAGAGAAACATAACGGCGGTACTCGAGTACCGCCGTTATGTTTCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032545.2-285s21c1
Sequence:CCGGTTTGGGAAACAGCTATCAAAGCTCGAGCTTTGATAGCTGTTTCCCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032545.2-337s21c1
Sequence:CCGGACCAAGGTTGCCACTCAGAAGCTCGAGCTTCTGAGTGGCAACCTTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032545
CFC1 MISSION shRNA shRNA Plasmid DNA
cripto, FRL-1, cryptic family 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032545.2-252s1c1
Sequence:CCGGGTTTACGGTCAGTTTGGCATTCTCGAGAATGCCAAACTGACCGTAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032545.2-273s1c1
Sequence:CCGGACAGATCATCAATTTGGGAAACTCGAGTTTCCCAAATTGATGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032545.2-687s1c1
Sequence:CCGGCCGCTGTGACCCGAAAGACTTCTCGAGAAGTCTTTCGGGTCACAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032545.2-375s1c1
Sequence:CCGGCAACTGGACCTCCAGTCATTTCTCGAGAAATGACTGGAGGTCCAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032545.2-305s1c1
Sequence:CCGGGAGAGAAACATAACGGCGGTACTCGAGTACCGCCGTTATGTTTCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032545.2-285s21c1
Sequence:CCGGTTTGGGAAACAGCTATCAAAGCTCGAGCTTTGATAGCTGTTTCCCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032545.2-337s21c1
Sequence:CCGGACCAAGGTTGCCACTCAGAAGCTCGAGCTTCTGAGTGGCAACCTTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032545
CFC1 MISSION shRNA Lentiviral Transduction Particles
cripto, FRL-1, cryptic family 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032545.2-252s1c1
Sequence:CCGGGTTTACGGTCAGTTTGGCATTCTCGAGAATGCCAAACTGACCGTAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032545.2-273s1c1
Sequence:CCGGACAGATCATCAATTTGGGAAACTCGAGTTTCCCAAATTGATGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032545.2-687s1c1
Sequence:CCGGCCGCTGTGACCCGAAAGACTTCTCGAGAAGTCTTTCGGGTCACAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032545.2-375s1c1
Sequence:CCGGCAACTGGACCTCCAGTCATTTCTCGAGAAATGACTGGAGGTCCAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032545.2-305s1c1
Sequence:CCGGGAGAGAAACATAACGGCGGTACTCGAGTACCGCCGTTATGTTTCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032545.2-285s21c1
Sequence:CCGGTTTGGGAAACAGCTATCAAAGCTCGAGCTTTGATAGCTGTTTCCCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032545.2-337s21c1
Sequence:CCGGACCAAGGTTGCCACTCAGAAGCTCGAGCTTCTGAGTGGCAACCTTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007685
CFC1 MISSION shRNA Bacterial Glycerol Stock
cripto, FRL-1, cryptic family 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007685.1-598s1c1
Sequence:CCGGGCCTATTTCACTGGTCGCTATCTCGAGATAGCGACCAGTGAAATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007685.1-428s1c1
Sequence:CCGGCACTGGACAGAACTCTGAGTACTCGAGTACTCAGAGTTCTGTCCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007685.1-776s1c1
Sequence:CCGGGCGCCAGAGGATCAAGAGAATCTCGAGATTCTCTTGATCCTCTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007685.1-430s1c1
Sequence:CCGGCTGGACAGAACTCTGAGTAATCTCGAGATTACTCAGAGTTCTGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007685.1-597s1c1
Sequence:CCGGTGCCTATTTCACTGGTCGCTACTCGAGTAGCGACCAGTGAAATAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007685
CFC1 MISSION shRNA shRNA Plasmid DNA
cripto, FRL-1, cryptic family 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007685.1-598s1c1
Sequence:CCGGGCCTATTTCACTGGTCGCTATCTCGAGATAGCGACCAGTGAAATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007685.1-428s1c1
Sequence:CCGGCACTGGACAGAACTCTGAGTACTCGAGTACTCAGAGTTCTGTCCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007685.1-776s1c1
Sequence:CCGGGCGCCAGAGGATCAAGAGAATCTCGAGATTCTCTTGATCCTCTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007685.1-430s1c1
Sequence:CCGGCTGGACAGAACTCTGAGTAATCTCGAGATTACTCAGAGTTCTGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007685.1-597s1c1
Sequence:CCGGTGCCTATTTCACTGGTCGCTACTCGAGTAGCGACCAGTGAAATAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007685
CFC1 MISSION shRNA Lentiviral Transduction Particles
cripto, FRL-1, cryptic family 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007685.1-598s1c1
Sequence:CCGGGCCTATTTCACTGGTCGCTATCTCGAGATAGCGACCAGTGAAATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007685.1-428s1c1
Sequence:CCGGCACTGGACAGAACTCTGAGTACTCGAGTACTCAGAGTTCTGTCCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007685.1-776s1c1
Sequence:CCGGGCGCCAGAGGATCAAGAGAATCTCGAGATTCTCTTGATCCTCTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007685.1-430s1c1
Sequence:CCGGCTGGACAGAACTCTGAGTAATCTCGAGATTACTCAGAGTTCTGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007685.1-597s1c1
Sequence:CCGGTGCCTATTTCACTGGTCGCTACTCGAGTAGCGACCAGTGAAATAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)