EMAIL THIS PAGE TO A FRIEND

CGN

cingulin

163 Gene Product Result for
UniProtKB ID: Q9P2M7, A6H8L3, A7MD22, Q5T386, Q9NR25
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020770 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020770 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020770 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001037711 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001037711 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001037711 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU210451 MISSION® esiRNA esiRNA targeting mouse Cgn mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020770 Rosetta Predictions human pricing
XM_001059265 Rosetta Predictions rat pricing
XM_227472 Rosetta Predictions rat pricing
NM_001037711 Rosetta Predictions mouse pricing
XM_001001375 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353902 predicted 1288
2 SASI_Hs01_00218449 predicted 3229
3 SASI_Hs01_00218450 predicted 675
4 SASI_Hs01_00218451 predicted 1529
5 SASI_Hs01_00218452 predicted 1080
6 SASI_Hs01_00218453 predicted 687
7 SASI_Hs02_00353903 predicted 1513
8 SASI_Hs01_00218455 predicted 1541
9 SASI_Hs01_00218456 predicted 3446
10 SASI_Hs01_00218457 predicted 426
11 SASI_Hs01_00218454 predicted 2882
12 SASI_Hs01_00218458 predicted 1190
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059265 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292677 predicted 1752
2 SASI_Rn02_00292678 predicted 2214
3 SASI_Rn02_00292679 predicted 828
4 SASI_Rn02_00292680 predicted 3614
5 SASI_Rn02_00292681 predicted 1331
6 SASI_Rn02_00292682 predicted 2840
7 SASI_Rn02_00292683 predicted 3611
8 SASI_Rn02_00292684 predicted 941
9 SASI_Rn02_00292685 predicted 899
10 SASI_Rn02_00292686 predicted 3698
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227472 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384431 predicted 1758
2 SASI_Rn02_00384432 predicted 2211
3 SASI_Rn02_00384433 predicted 3623
4 SASI_Rn02_00384434 predicted 1326
5 SASI_Rn02_00384435 predicted 2843
6 SASI_Rn02_00384436 predicted 3605
7 SASI_Rn02_00384437 predicted 3694
8 SASI_Rn02_00384438 predicted 2210
9 SASI_Rn02_00384439 predicted 1743
10 SASI_Rn02_00384440 predicted 3587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289320 predicted 582
2 SASI_Mm02_00289321 predicted 1480
3 SASI_Mm02_00289322 predicted 2583
4 SASI_Mm02_00289323 predicted 2299
5 SASI_Mm02_00289324 predicted 342
6 SASI_Mm02_00289325 predicted 3361
7 SASI_Mm02_00289326 predicted 1559
8 SASI_Mm02_00289327 predicted 1526
9 SASI_Mm02_00289328 predicted 579
10 SASI_Mm02_00289329 predicted 2982
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230354 predicted 806
2 SASI_Mm02_00355104 predicted 903
3 SASI_Mm01_00230359 predicted 3579
4 SASI_Mm02_00355105 predicted 1254
5 SASI_Mm02_00355106 predicted 1229
6 SASI_Mm02_00355107 predicted 805
7 SASI_Mm02_00355108 predicted 3654
8 SASI_Mm02_00355109 predicted 1289
9 SASI_Mm02_00355110 predicted 1234
10 SASI_Mm02_00355111 predicted 1097
11 SASI_Mm01_00230355 predicted 1701
12 SASI_Mm01_00230356 predicted 2805
13 SASI_Mm01_00230357 predicted 2978
14 SASI_Mm01_00230358 predicted 564
15 SASI_Mm01_00230360 predicted 1783
16 SASI_Mm01_00230361 predicted 320
17 SASI_Mm01_00230362 predicted 1748
18 SASI_Mm01_00230363 predicted 3196
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020770
VALIDATED
CGN MISSION shRNA Bacterial Glycerol Stock
cingulin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020770.1-2001s1c1
Sequence:CCGGCCCGAGCTAGTGCTGGAGATACTCGAGTATCTCCAGCACTAGCTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020770.1-686s1c1
Sequence:CCGGGACTCACTCATCAACAAGTTTCTCGAGAAACTTGTTGATGAGTGAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020770.1-3430s1c1
Sequence:CCGGGCAGCATGTCAATGACCAGAACTCGAGTTCTGGTCATTGACATGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020770.1-4416s1c1
Sequence:CCGGGCACATTCATACCTCTCCAAACTCGAGTTTGGAGAGGTATGAATGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020770.1-3068s1c1
Sequence:CCGGCGGCTGGAAACAGAGTTAGATCTCGAGATCTAACTCTGTTTCCAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020770.2-1141s21c1
Sequence:CCGGGTGAGGAGGAAGGTTAGTTTGCTCGAGCAAACTAACCTTCCTCCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020770.2-3104s21c1
Sequence:CCGGTGCTAACAGATCGGGTGAATCCTCGAGGATTCACCCGATCTGTTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020770.2-1435s21c1
Sequence:CCGGTTGGACCAGGGTGAAGATTTACTCGAGTAAATCTTCACCCTGGTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020770.2-3843s21c1
Sequence:CCGGCCTATGGGTGACCCAATTATTCTCGAGAATAATTGGGTCACCCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020770.2-2762s21c1
Sequence:CCGGAGGCCCAGCTGGAGGATTATACTCGAGTATAATCCTCCAGCTGGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020770
VALIDATED
CGN MISSION shRNA shRNA Plasmid DNA
cingulin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020770.1-2001s1c1
Sequence:CCGGCCCGAGCTAGTGCTGGAGATACTCGAGTATCTCCAGCACTAGCTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020770.1-686s1c1
Sequence:CCGGGACTCACTCATCAACAAGTTTCTCGAGAAACTTGTTGATGAGTGAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020770.1-3430s1c1
Sequence:CCGGGCAGCATGTCAATGACCAGAACTCGAGTTCTGGTCATTGACATGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020770.1-4416s1c1
Sequence:CCGGGCACATTCATACCTCTCCAAACTCGAGTTTGGAGAGGTATGAATGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020770.1-3068s1c1
Sequence:CCGGCGGCTGGAAACAGAGTTAGATCTCGAGATCTAACTCTGTTTCCAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020770.2-1141s21c1
Sequence:CCGGGTGAGGAGGAAGGTTAGTTTGCTCGAGCAAACTAACCTTCCTCCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020770.2-3104s21c1
Sequence:CCGGTGCTAACAGATCGGGTGAATCCTCGAGGATTCACCCGATCTGTTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020770.2-1435s21c1
Sequence:CCGGTTGGACCAGGGTGAAGATTTACTCGAGTAAATCTTCACCCTGGTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020770.2-3843s21c1
Sequence:CCGGCCTATGGGTGACCCAATTATTCTCGAGAATAATTGGGTCACCCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020770.2-2762s21c1
Sequence:CCGGAGGCCCAGCTGGAGGATTATACTCGAGTATAATCCTCCAGCTGGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020770
VALIDATED
CGN MISSION shRNA Lentiviral Transduction Particles
cingulin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020770.1-2001s1c1
Sequence:CCGGCCCGAGCTAGTGCTGGAGATACTCGAGTATCTCCAGCACTAGCTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020770.1-686s1c1
Sequence:CCGGGACTCACTCATCAACAAGTTTCTCGAGAAACTTGTTGATGAGTGAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020770.1-3430s1c1
Sequence:CCGGGCAGCATGTCAATGACCAGAACTCGAGTTCTGGTCATTGACATGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020770.1-4416s1c1
Sequence:CCGGGCACATTCATACCTCTCCAAACTCGAGTTTGGAGAGGTATGAATGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020770.1-3068s1c1
Sequence:CCGGCGGCTGGAAACAGAGTTAGATCTCGAGATCTAACTCTGTTTCCAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020770.2-1141s21c1
Sequence:CCGGGTGAGGAGGAAGGTTAGTTTGCTCGAGCAAACTAACCTTCCTCCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020770.2-3104s21c1
Sequence:CCGGTGCTAACAGATCGGGTGAATCCTCGAGGATTCACCCGATCTGTTAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020770.2-1435s21c1
Sequence:CCGGTTGGACCAGGGTGAAGATTTACTCGAGTAAATCTTCACCCTGGTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020770.2-3843s21c1
Sequence:CCGGCCTATGGGTGACCCAATTATTCTCGAGAATAATTGGGTCACCCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_020770.2-2762s21c1
Sequence:CCGGAGGCCCAGCTGGAGGATTATACTCGAGTATAATCCTCCAGCTGGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037711
VALIDATED
CGN MISSION shRNA Bacterial Glycerol Stock
cingulin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037711.2-202s21c1
Sequence:CCGGTGGAGTTCAAATTCGATTTATCTCGAGATAAATCGAATTTGAACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037711.2-3873s21c1
Sequence:CCGGAGTGATGGTGATAAACTTTAGCTCGAGCTAAAGTTTATCACCATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037711.2-637s21c1
Sequence:CCGGTAAACCGACTTCCTCGATTAACTCGAGTTAATCGAGGAAGTCGGTTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037711.2-1133s21c1
Sequence:CCGGGTGAGGAGGAAAGTTAGTTTGCTCGAGCAAACTAACTTTCCTCCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037711.2-587s21c1
Sequence:CCGGGCCTTTATGAGTCCTAGTAATCTCGAGATTACTAGGACTCATAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037711
VALIDATED
CGN MISSION shRNA shRNA Plasmid DNA
cingulin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037711.2-202s21c1
Sequence:CCGGTGGAGTTCAAATTCGATTTATCTCGAGATAAATCGAATTTGAACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037711.2-3873s21c1
Sequence:CCGGAGTGATGGTGATAAACTTTAGCTCGAGCTAAAGTTTATCACCATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037711.2-637s21c1
Sequence:CCGGTAAACCGACTTCCTCGATTAACTCGAGTTAATCGAGGAAGTCGGTTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037711.2-1133s21c1
Sequence:CCGGGTGAGGAGGAAAGTTAGTTTGCTCGAGCAAACTAACTTTCCTCCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037711.2-587s21c1
Sequence:CCGGGCCTTTATGAGTCCTAGTAATCTCGAGATTACTAGGACTCATAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037711
VALIDATED
CGN MISSION shRNA Lentiviral Transduction Particles
cingulin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037711.2-202s21c1
Sequence:CCGGTGGAGTTCAAATTCGATTTATCTCGAGATAAATCGAATTTGAACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037711.2-3873s21c1
Sequence:CCGGAGTGATGGTGATAAACTTTAGCTCGAGCTAAAGTTTATCACCATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037711.2-637s21c1
Sequence:CCGGTAAACCGACTTCCTCGATTAACTCGAGTTAATCGAGGAAGTCGGTTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037711.2-1133s21c1
Sequence:CCGGGTGAGGAGGAAAGTTAGTTTGCTCGAGCAAACTAACTTTCCTCCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037711.2-587s21c1
Sequence:CCGGGCCTTTATGAGTCCTAGTAATCTCGAGATTACTAGGACTCATAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)