EMAIL THIS PAGE TO A FRIEND

CHAMP1

chromosome alignment maintaining phosphoprotein 1

99 Gene Product Result for
Synonyms: C13orf8 CAMP CHAMP ZNF828
UniProtKB ID: Q96JM3, B3KU06, Q6P181, Q8NC88, Q9BST0
Gene ID:
Mouse(101994) chromosome alignment maintaining phosphoprotein 1
Rat(306647) chromosome alignment maintaining phosphoprotein 1
chicken(418733) chromosome alignment maintaining phosphoprotein 1
cow(100137827) chromosome alignment maintaining phosphoprotein 1
naked mole-rat(101722945) chromosome alignment maintaining phosphoprotein 1
domestic guinea pig(101789198) chromosome alignment maintaining phosphoprotein 1
sheep(101118032) chromosome alignment maintaining phosphoprotein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181854 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181854 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181854 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032436 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032436 Rosetta Predictions human pricing
NM_001107329 Rosetta Predictions rat pricing
NM_181854 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124596 predicted 2567
2 SASI_Hs01_00124598 predicted 2497
3 SASI_Hs02_00359843 predicted 2640
4 SASI_Hs01_00124599 predicted 2222
5 SASI_Hs01_00124601 predicted 2235
6 SASI_Hs01_00124602 predicted 2632
7 SASI_Hs01_00124604 predicted 510
8 SASI_Hs01_00124605 predicted 486
9 SASI_Hs02_00359844 predicted 681
10 SASI_Hs02_00359845 predicted 316
11 SASI_Hs01_00124597 predicted 2178
12 SASI_Hs01_00124600 predicted 2492
13 SASI_Hs01_00124603 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107329 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227765 predicted 1563
2 SASI_Rn02_00227766 predicted 1576
3 SASI_Rn02_00227767 predicted 2395
4 SASI_Rn02_00227768 predicted 1792
5 SASI_Rn02_00227769 predicted 2182
6 SASI_Rn02_00227770 predicted 1946
7 SASI_Rn02_00227771 predicted 1154
8 SASI_Rn02_00227772 predicted 1629
9 SASI_Rn02_00227773 predicted 248
10 SASI_Rn02_00227774 predicted 2588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139909 predicted 2619
2 SASI_Mm01_00139910 predicted 2458
3 SASI_Mm01_00139912 predicted 2385
4 SASI_Mm01_00139913 predicted 1986
5 SASI_Mm02_00349940 predicted 412
6 SASI_Mm01_00139914 predicted 1551
7 SASI_Mm01_00139915 predicted 2265
8 SASI_Mm01_00139916 predicted 2424
9 SASI_Mm01_00139917 predicted 1785
10 SASI_Mm01_00139918 predicted 2383
11 SASI_Mm01_00139911 predicted 2117
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181854
CHAMP1 MISSION shRNA Bacterial Glycerol Stock
chromosome alignment maintaining phosphoprotein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181854.1-351s1c1
Sequence:CCGGCGCCAATGTGTACTATCACATCTCGAGATGTGATAGTACACATTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181854.1-2376s1c1
Sequence:CCGGCCACGGGCAGAGTTTACTTAACTCGAGTTAAGTAAACTCTGCCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181854.1-1989s1c1
Sequence:CCGGGCTCAGTAGCAGTGAATACATCTCGAGATGTATTCACTGCTACTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181854.1-2277s1c1
Sequence:CCGGCCACTTGGTTAATAAGCACAACTCGAGTTGTGCTTATTAACCAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181854.1-957s1c1
Sequence:CCGGTCCTGAACTTTGGAAGCCATTCTCGAGAATGGCTTCCAAAGTTCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181854
CHAMP1 MISSION shRNA shRNA Plasmid DNA
chromosome alignment maintaining phosphoprotein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181854.1-351s1c1
Sequence:CCGGCGCCAATGTGTACTATCACATCTCGAGATGTGATAGTACACATTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181854.1-2376s1c1
Sequence:CCGGCCACGGGCAGAGTTTACTTAACTCGAGTTAAGTAAACTCTGCCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181854.1-1989s1c1
Sequence:CCGGGCTCAGTAGCAGTGAATACATCTCGAGATGTATTCACTGCTACTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181854.1-2277s1c1
Sequence:CCGGCCACTTGGTTAATAAGCACAACTCGAGTTGTGCTTATTAACCAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181854.1-957s1c1
Sequence:CCGGTCCTGAACTTTGGAAGCCATTCTCGAGAATGGCTTCCAAAGTTCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181854
CHAMP1 MISSION shRNA Lentiviral Transduction Particles
chromosome alignment maintaining phosphoprotein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181854.1-351s1c1
Sequence:CCGGCGCCAATGTGTACTATCACATCTCGAGATGTGATAGTACACATTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181854.1-2376s1c1
Sequence:CCGGCCACGGGCAGAGTTTACTTAACTCGAGTTAAGTAAACTCTGCCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181854.1-1989s1c1
Sequence:CCGGGCTCAGTAGCAGTGAATACATCTCGAGATGTATTCACTGCTACTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181854.1-2277s1c1
Sequence:CCGGCCACTTGGTTAATAAGCACAACTCGAGTTGTGCTTATTAACCAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181854.1-957s1c1
Sequence:CCGGTCCTGAACTTTGGAAGCCATTCTCGAGAATGGCTTCCAAAGTTCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032436
CHAMP1 MISSION shRNA Bacterial Glycerol Stock
chromosome alignment maintaining phosphoprotein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032436.1-856s1c1
Sequence:CCGGCCTGTTTGTGAGTCTCAGAAACTCGAGTTTCTGAGACTCACAAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032436.1-2086s1c1
Sequence:CCGGGCTTCACCTAAGAAACTCTTACTCGAGTAAGAGTTTCTTAGGTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150655    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032436.1-3019s1c1
Sequence:CCGGGCAAGTTGTACTCAAAGCATTCTCGAGAATGCTTTGAGTACAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032436.1-2650s1c1
Sequence:CCGGCGGCATAATGAAGAGGCAAATCTCGAGATTTGCCTCTTCATTATGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032436.1-683s1c1
Sequence:CCGGCACAGAAACTTGGTTCAGTTTCTCGAGAAACTGAACCAAGTTTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032436.1-3578s1c1
Sequence:CCGGGAACTGAAAGTCTTCCAGATTCTCGAGAATCTGGAAGACTTTCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032436.1-457s1c1
Sequence:CCGGGCAAAGTTATTTCACTGCCATCTCGAGATGGCAGTGAAATAACTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032436.1-1487s1c1
Sequence:CCGGCCACGTTGTCTCCTGAACATTCTCGAGAATGTTCAGGAGACAACGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032436.1-2501s1c1
Sequence:CCGGGCACAATCTGTGGAAAGGCTTCTCGAGAAGCCTTTCCACAGATTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032436.1-2830s1c1
Sequence:CCGGCCGTGTTTCACTGTCTCAGTTCTCGAGAACTGAGACAGTGAAACACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032436
CHAMP1 MISSION shRNA shRNA Plasmid DNA
chromosome alignment maintaining phosphoprotein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032436.1-856s1c1
Sequence:CCGGCCTGTTTGTGAGTCTCAGAAACTCGAGTTTCTGAGACTCACAAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032436.1-2086s1c1
Sequence:CCGGGCTTCACCTAAGAAACTCTTACTCGAGTAAGAGTTTCTTAGGTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150655    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032436.1-3019s1c1
Sequence:CCGGGCAAGTTGTACTCAAAGCATTCTCGAGAATGCTTTGAGTACAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032436.1-2650s1c1
Sequence:CCGGCGGCATAATGAAGAGGCAAATCTCGAGATTTGCCTCTTCATTATGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032436.1-683s1c1
Sequence:CCGGCACAGAAACTTGGTTCAGTTTCTCGAGAAACTGAACCAAGTTTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032436.1-3578s1c1
Sequence:CCGGGAACTGAAAGTCTTCCAGATTCTCGAGAATCTGGAAGACTTTCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032436.1-457s1c1
Sequence:CCGGGCAAAGTTATTTCACTGCCATCTCGAGATGGCAGTGAAATAACTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032436.1-1487s1c1
Sequence:CCGGCCACGTTGTCTCCTGAACATTCTCGAGAATGTTCAGGAGACAACGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032436.1-2501s1c1
Sequence:CCGGGCACAATCTGTGGAAAGGCTTCTCGAGAAGCCTTTCCACAGATTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032436.1-2830s1c1
Sequence:CCGGCCGTGTTTCACTGTCTCAGTTCTCGAGAACTGAGACAGTGAAACACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032436
CHAMP1 MISSION shRNA Lentiviral Transduction Particles
chromosome alignment maintaining phosphoprotein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032436.1-856s1c1
Sequence:CCGGCCTGTTTGTGAGTCTCAGAAACTCGAGTTTCTGAGACTCACAAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032436.1-2086s1c1
Sequence:CCGGGCTTCACCTAAGAAACTCTTACTCGAGTAAGAGTTTCTTAGGTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150655    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032436.1-3019s1c1
Sequence:CCGGGCAAGTTGTACTCAAAGCATTCTCGAGAATGCTTTGAGTACAACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032436.1-2650s1c1
Sequence:CCGGCGGCATAATGAAGAGGCAAATCTCGAGATTTGCCTCTTCATTATGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032436.1-683s1c1
Sequence:CCGGCACAGAAACTTGGTTCAGTTTCTCGAGAAACTGAACCAAGTTTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032436.1-3578s1c1
Sequence:CCGGGAACTGAAAGTCTTCCAGATTCTCGAGAATCTGGAAGACTTTCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032436.1-457s1c1
Sequence:CCGGGCAAAGTTATTTCACTGCCATCTCGAGATGGCAGTGAAATAACTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032436.1-1487s1c1
Sequence:CCGGCCACGTTGTCTCCTGAACATTCTCGAGAATGTTCAGGAGACAACGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032436.1-2501s1c1
Sequence:CCGGGCACAATCTGTGGAAAGGCTTCTCGAGAAGCCTTTCCACAGATTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032436.1-2830s1c1
Sequence:CCGGCCGTGTTTCACTGTCTCAGTTCTCGAGAACTGAGACAGTGAAACACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)