EMAIL THIS PAGE TO A FRIEND

CHD7

chromodomain helicase DNA binding protein 7

179 Gene Product Result for
Synonyms: HH5 IS3 KAL5
Gene ID:
Human(55636) Summary: This gene encodes a protein that contains several helicase family domains. Mutations in this gene have been found in some patients with the CHARGE syndrome. [provided by RefSeq, Jul 2008]
Mouse(320790) chromodomain helicase DNA binding protein 7
Rat(312974) chromodomain helicase DNA binding protein 7
Zebrafish(569471) chromodomain helicase DNA binding protein 7
chicken(421140) chromodomain helicase DNA binding protein 7
dog(486968) chromodomain helicase DNA binding protein 7
domestic cat(101083999) chromodomain helicase DNA binding protein 7
Horse(100052622) chromodomain helicase DNA binding protein 7
cow(533175) chromodomain helicase DNA binding protein 7
domestic guinea pig(100720856) chromodomain helicase DNA binding protein 7
naked mole-rat(101696944) chromodomain helicase DNA binding protein 7
sheep(101111107) chromodomain helicase DNA binding protein 7
Domestic Rabbit(100339550) chromodomain helicase DNA binding protein 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_098762 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_098762 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_098762 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081417 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081417 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081417 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017780 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017780 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017780 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017780 Rosetta Predictions human pricing
NM_001107906 Rosetta Predictions rat pricing
NM_001081417 Rosetta Predictions mouse pricing
XM_985866 Rosetta Predictions mouse pricing
XM_985899 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350626 predicted 3138
2 SASI_Hs02_00350627 predicted 5753
3 SASI_Hs01_00037144 predicted 5717
4 SASI_Hs01_00037146 predicted 4179
5 SASI_Hs01_00037147 predicted 3828
6 SASI_Hs01_00037148 predicted 3079
7 SASI_Hs01_00037149 predicted 5116
8 SASI_Hs01_00037151 predicted 1426
9 SASI_Hs02_00350628 predicted 5841
10 SASI_Hs01_00037152 predicted 3752
11 SASI_Hs01_00037145 predicted 3110
12 SASI_Hs01_00037150 predicted 8061
13 SASI_Hs01_00037153 predicted 7380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107906 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233445 predicted 4847
2 SASI_Rn02_00233446 predicted 5601
3 SASI_Rn02_00233447 predicted 4757
4 SASI_Rn02_00233448 predicted 5721
5 SASI_Rn02_00233449 predicted 6216
6 SASI_Rn02_00233450 predicted 4960
7 SASI_Rn02_00233451 predicted 6114
8 SASI_Rn02_00233452 predicted 5456
9 SASI_Rn02_00233453 predicted 6035
10 SASI_Rn02_00233454 predicted 7283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081417 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298181 predicted 2960
2 SASI_Mm02_00298182 predicted 2933
3 SASI_Mm02_00298183 predicted 5535
4 SASI_Mm02_00298184 predicted 4699
5 SASI_Mm02_00298185 predicted 4759
6 SASI_Mm02_00298186 predicted 5074
7 SASI_Mm02_00298187 predicted 6045
8 SASI_Mm02_00298188 predicted 3298
9 SASI_Mm02_00298189 predicted 2907
10 SASI_Mm02_00298190 predicted 1252
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_985866 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234434 predicted 7666
2 SASI_Mm01_00234435 predicted 7649
3 SASI_Mm01_00234436 predicted 8554
4 SASI_Mm01_00234437 predicted 8498
5 SASI_Mm01_00234438 predicted 7688
6 SASI_Mm01_00234439 predicted 7675
7 SASI_Mm01_00234440 predicted 8559
8 SASI_Mm01_00234441 predicted 7652
9 SASI_Mm01_00234442 predicted 7583
10 SASI_Mm01_00234443 predicted 7655
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_985899 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280446 predicted 1800
2 SASI_Mm01_00280447 predicted 1806
3 SASI_Mm01_00280448 predicted 1539
4 SASI_Mm01_00280449 predicted 739
5 SASI_Mm01_00280450 predicted 1799
6 SASI_Mm01_00280451 predicted 1393
7 SASI_Mm01_00280452 predicted 795
8 SASI_Mm01_00280453 predicted 728
9 SASI_Mm01_00280454 predicted 1506
10 SASI_Mm01_00280455 predicted 1539
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_098762
VALIDATED
CHD7 MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:XM_098762.11-8181s1c1
Sequence:CCGGCCCTACTTACACTGTTGATATCTCGAGATATCAACAGTGTAAGTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098762.11-5974s1c1
Sequence:CCGGCCGTTCAAAGATGAAATAGATCTCGAGATCTATTTCATCTTTGAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098762.11-3547s1c1
Sequence:CCGGCGGACCATTCAGTTGTATGAACTCGAGTTCATACAACTGAATGGTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098762.11-7396s1c1
Sequence:CCGGCGCCAGATGTTTGATTTCCAACTCGAGTTGGAAATCAAACATCTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098762.11-4139s1c1
Sequence:CCGGGCTGCAATCATCCGTACCTTACTCGAGTAAGGTACGGATGATTGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_098762
VALIDATED
CHD7 MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:XM_098762.11-8181s1c1
Sequence:CCGGCCCTACTTACACTGTTGATATCTCGAGATATCAACAGTGTAAGTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098762.11-5974s1c1
Sequence:CCGGCCGTTCAAAGATGAAATAGATCTCGAGATCTATTTCATCTTTGAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098762.11-3547s1c1
Sequence:CCGGCGGACCATTCAGTTGTATGAACTCGAGTTCATACAACTGAATGGTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098762.11-7396s1c1
Sequence:CCGGCGCCAGATGTTTGATTTCCAACTCGAGTTGGAAATCAAACATCTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098762.11-4139s1c1
Sequence:CCGGGCTGCAATCATCCGTACCTTACTCGAGTAAGGTACGGATGATTGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_098762
VALIDATED
CHD7 MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:XM_098762.11-8181s1c1
Sequence:CCGGCCCTACTTACACTGTTGATATCTCGAGATATCAACAGTGTAAGTAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098762.11-5974s1c1
Sequence:CCGGCCGTTCAAAGATGAAATAGATCTCGAGATCTATTTCATCTTTGAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098762.11-3547s1c1
Sequence:CCGGCGGACCATTCAGTTGTATGAACTCGAGTTCATACAACTGAATGGTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098762.11-7396s1c1
Sequence:CCGGCGCCAGATGTTTGATTTCCAACTCGAGTTGGAAATCAAACATCTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_098762.11-4139s1c1
Sequence:CCGGGCTGCAATCATCCGTACCTTACTCGAGTAAGGTACGGATGATTGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081417
CHD7 MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081417.1-3568s21c1
Sequence:CCGGCTGTCCTGAGCTGCGTAATATCTCGAGATATTACGCAGCTCAGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081417.1-2941s21c1
Sequence:CCGGTGTGGAAGTTGACCGGATAATCTCGAGATTATCCGGTCAACTTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081417.1-3167s21c1
Sequence:CCGGGAGAGTTCCAGGGAGTATAAACTCGAGTTTATACTCCCTGGAACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081417.1-8099s21c1
Sequence:CCGGACTGTCGATATGCCGAGTTATCTCGAGATAACTCGGCATATCGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081417.1-6053s21c1
Sequence:CCGGGCCTATCAGCGCAGCTATAAACTCGAGTTTATAGCTGCGCTGATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081417
CHD7 MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081417.1-3568s21c1
Sequence:CCGGCTGTCCTGAGCTGCGTAATATCTCGAGATATTACGCAGCTCAGGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081417.1-2941s21c1
Sequence:CCGGTGTGGAAGTTGACCGGATAATCTCGAGATTATCCGGTCAACTTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081417.1-3167s21c1
Sequence:CCGGGAGAGTTCCAGGGAGTATAAACTCGAGTTTATACTCCCTGGAACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081417.1-8099s21c1
Sequence:CCGGACTGTCGATATGCCGAGTTATCTCGAGATAACTCGGCATATCGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081417.1-6053s21c1
Sequence:CCGGGCCTATCAGCGCAGCTATAAACTCGAGTTTATAGCTGCGCTGATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081417
CHD7 MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081417.1-3568s21c1
Sequence:CCGGCTGTCCTGAGCTGCGTAATATCTCGAGATATTACGCAGCTCAGGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081417.1-2941s21c1
Sequence:CCGGTGTGGAAGTTGACCGGATAATCTCGAGATTATCCGGTCAACTTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081417.1-3167s21c1
Sequence:CCGGGAGAGTTCCAGGGAGTATAAACTCGAGTTTATACTCCCTGGAACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081417.1-8099s21c1
Sequence:CCGGACTGTCGATATGCCGAGTTATCTCGAGATAACTCGGCATATCGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081417.1-6053s21c1
Sequence:CCGGGCCTATCAGCGCAGCTATAAACTCGAGTTTATAGCTGCGCTGATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017780
CHD7 MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017780.2-9647s21c1
Sequence:CCGGGTATTGTGCAGTGCATTATTTCTCGAGAAATAATGCACTGCACAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017780.2-6333s21c1
Sequence:CCGGAGCGGAAAGGGAAGCTATTATCTCGAGATAATAGCTTCCCTTTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017780.2-3346s21c1
Sequence:CCGGGAGAGTTCCAGGGAGTATAAACTCGAGTTTATACTCCCTGGAACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017780.2-6232s21c1
Sequence:CCGGGCCTATCAGCGCAGCTATAAACTCGAGTTTATAGCTGCGCTGATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017780.2-4184s21c1
Sequence:CCGGCTAACGTACCTAACCTATTAACTCGAGTTAATAGGTTAGGTACGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017780
CHD7 MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017780.2-9647s21c1
Sequence:CCGGGTATTGTGCAGTGCATTATTTCTCGAGAAATAATGCACTGCACAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017780.2-6333s21c1
Sequence:CCGGAGCGGAAAGGGAAGCTATTATCTCGAGATAATAGCTTCCCTTTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017780.2-3346s21c1
Sequence:CCGGGAGAGTTCCAGGGAGTATAAACTCGAGTTTATACTCCCTGGAACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017780.2-6232s21c1
Sequence:CCGGGCCTATCAGCGCAGCTATAAACTCGAGTTTATAGCTGCGCTGATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017780.2-4184s21c1
Sequence:CCGGCTAACGTACCTAACCTATTAACTCGAGTTAATAGGTTAGGTACGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017780
CHD7 MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017780.2-9647s21c1
Sequence:CCGGGTATTGTGCAGTGCATTATTTCTCGAGAAATAATGCACTGCACAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017780.2-6333s21c1
Sequence:CCGGAGCGGAAAGGGAAGCTATTATCTCGAGATAATAGCTTCCCTTTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017780.2-3346s21c1
Sequence:CCGGGAGAGTTCCAGGGAGTATAAACTCGAGTTTATACTCCCTGGAACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017780.2-6232s21c1
Sequence:CCGGGCCTATCAGCGCAGCTATAAACTCGAGTTTATAGCTGCGCTGATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017780.2-4184s21c1
Sequence:CCGGCTAACGTACCTAACCTATTAACTCGAGTTAATAGGTTAGGTACGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)