EMAIL THIS PAGE TO A FRIEND

CHIAP2

chitinase, acidic pseudogene 2

22 Gene Product Result for
Species: Human CHIAP2(149620)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013621 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013621 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013621 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013621 Rosetta Predictions human pricing
NR_003928 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172966 predicted 1651
2 SASI_Hs01_00172967 predicted 1692
3 SASI_Hs01_00172968 predicted 1594
4 SASI_Hs01_00172969 predicted 1566
5 SASI_Hs01_00172970 predicted 1772
6 SASI_Hs01_00172971 predicted 1706
7 SASI_Hs01_00172972 predicted 1492
8 SASI_Hs01_00172973 predicted 1643
9 SASI_Hs01_00172974 predicted 1650
10 SASI_Hs01_00172975 predicted 1463
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00380541 predicted 335
2 SASI_Hs02_00380542 predicted 259
3 SASI_Hs02_00380543 predicted 1627
4 SASI_Hs02_00380544 predicted 362
5 SASI_Hs02_00380545 predicted 1661
6 SASI_Hs02_00380546 predicted 1742
7 SASI_Hs02_00380547 predicted 279
8 SASI_Hs02_00380548 predicted 1622
9 SASI_Hs02_00380549 predicted 1596
10 SASI_Hs02_00380550 predicted 1564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013621
CHIAP2 MISSION shRNA Bacterial Glycerol Stock
chitinase, acidic pseudogene 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013621.1-1447s1c1
Sequence:CCGGCATGTTGGATTCCCAGCCTATCTCGAGATAGGCTGGGAATCCAACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013621.1-1949s1c1
Sequence:CCGGCCATTCCTATCTGGTAACAATCTCGAGATTGTTACCAGATAGGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013621.1-1018s1c1
Sequence:CCGGGACTTTCATCAACTCAGTCATCTCGAGATGACTGAGTTGATGAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013621.1-1925s1c1
Sequence:CCGGGCACAAGTAATTGTCTGACATCTCGAGATGTCAGACAATTACTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013621.1-1176s1c1
Sequence:CCGGCCAAGCACATTAATAAGCCCACTCGAGTGGGCTTATTAATGTGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013621.1-1183s1c1
Sequence:CCGGCATTAATAAGCCCAGGCTGATCTCGAGATCAGCCTGGGCTTATTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013621.1-1436s1c1
Sequence:CCGGGCTGAGAAGCTCATGTTGGATCTCGAGATCCAACATGAGCTTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013621.1-1441s1c1
Sequence:CCGGGAAGCTCATGTTGGATTCCCACTCGAGTGGGAATCCAACATGAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013621.1-2671s1c1
Sequence:CCGGGCCTCCTACAGTTGTGTGAATCTCGAGATTCACACAACTGTAGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013621.1-1144s1c1
Sequence:CCGGGCAGGAAATGCGTGAAGCTTTCTCGAGAAAGCTTCACGCATTTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013621
CHIAP2 MISSION shRNA shRNA Plasmid DNA
chitinase, acidic pseudogene 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013621.1-1447s1c1
Sequence:CCGGCATGTTGGATTCCCAGCCTATCTCGAGATAGGCTGGGAATCCAACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013621.1-1949s1c1
Sequence:CCGGCCATTCCTATCTGGTAACAATCTCGAGATTGTTACCAGATAGGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013621.1-1018s1c1
Sequence:CCGGGACTTTCATCAACTCAGTCATCTCGAGATGACTGAGTTGATGAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013621.1-1925s1c1
Sequence:CCGGGCACAAGTAATTGTCTGACATCTCGAGATGTCAGACAATTACTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013621.1-1176s1c1
Sequence:CCGGCCAAGCACATTAATAAGCCCACTCGAGTGGGCTTATTAATGTGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013621.1-1183s1c1
Sequence:CCGGCATTAATAAGCCCAGGCTGATCTCGAGATCAGCCTGGGCTTATTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013621.1-1436s1c1
Sequence:CCGGGCTGAGAAGCTCATGTTGGATCTCGAGATCCAACATGAGCTTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013621.1-1441s1c1
Sequence:CCGGGAAGCTCATGTTGGATTCCCACTCGAGTGGGAATCCAACATGAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013621.1-2671s1c1
Sequence:CCGGGCCTCCTACAGTTGTGTGAATCTCGAGATTCACACAACTGTAGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013621.1-1144s1c1
Sequence:CCGGGCAGGAAATGCGTGAAGCTTTCTCGAGAAAGCTTCACGCATTTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013621
CHIAP2 MISSION shRNA Lentiviral Transduction Particles
chitinase, acidic pseudogene 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013621.1-1447s1c1
Sequence:CCGGCATGTTGGATTCCCAGCCTATCTCGAGATAGGCTGGGAATCCAACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013621.1-1949s1c1
Sequence:CCGGCCATTCCTATCTGGTAACAATCTCGAGATTGTTACCAGATAGGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013621.1-1018s1c1
Sequence:CCGGGACTTTCATCAACTCAGTCATCTCGAGATGACTGAGTTGATGAAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013621.1-1925s1c1
Sequence:CCGGGCACAAGTAATTGTCTGACATCTCGAGATGTCAGACAATTACTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013621.1-1176s1c1
Sequence:CCGGCCAAGCACATTAATAAGCCCACTCGAGTGGGCTTATTAATGTGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013621.1-1183s1c1
Sequence:CCGGCATTAATAAGCCCAGGCTGATCTCGAGATCAGCCTGGGCTTATTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013621.1-1436s1c1
Sequence:CCGGGCTGAGAAGCTCATGTTGGATCTCGAGATCCAACATGAGCTTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013621.1-1441s1c1
Sequence:CCGGGAAGCTCATGTTGGATTCCCACTCGAGTGGGAATCCAACATGAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013621.1-2671s1c1
Sequence:CCGGGCCTCCTACAGTTGTGTGAATCTCGAGATTCACACAACTGTAGGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013621.1-1144s1c1
Sequence:CCGGGCAGGAAATGCGTGAAGCTTTCTCGAGAAAGCTTCACGCATTTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)