EMAIL THIS PAGE TO A FRIEND

CHIC1

cysteine-rich hydrophobic domain 1

162 Gene Product Result for
Synonyms: BRX
UniProtKB ID: Q5VXU3, A0PJZ2, B0QZ87, B9EGS5, Q5CZ84
Gene ID:
Mouse(12212) cysteine-rich hydrophobic domain 1
Rat(363484) cysteine-rich hydrophobic domain 1
Zebrafish(564524) cysteine-rich hydrophobic domain 1
chicken(422318) cysteine-rich hydrophobic domain 1
cow(615065) cysteine-rich hydrophobic domain 1
domestic cat(101098121) cysteine-rich hydrophobic domain 1
sheep(101112030) cysteine-rich hydrophobic domain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV44893 Anti-CHIC1 antibody produced in rabbit IgG fraction of antiserum , rabbit, mouse, bovine, human, canine, zebrafish, horse, guinea pig, rat
western blot pricing
HPA052062 Anti-CHIC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009767 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009767 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009767 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001039840 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039840 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039840 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039840 Rosetta Predictions human pricing
XM_001055438 Rosetta Predictions rat pricing
XM_001056014 Rosetta Predictions rat pricing
NM_009767 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196256 predicted 756
2 SASI_Hs02_00308680 predicted 712
3 SASI_Hs01_00196257 predicted 1073
4 SASI_Hs01_00196259 predicted 729
5 SASI_Hs01_00196260 predicted 647
6 SASI_Hs01_00196261 predicted 855
7 SASI_Hs01_00196264 predicted 978
8 SASI_Hs01_00196265 predicted 787
9 SASI_Hs02_00308681 predicted 736
10 SASI_Hs02_00308682 predicted 892
11 SASI_Hs01_00196258 predicted 1009
12 SASI_Hs01_00196262 predicted 1003
13 SASI_Hs01_00196263 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055438 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279522 predicted 836
2 SASI_Rn02_00279523 predicted 931
3 SASI_Rn02_00279524 predicted 728
4 SASI_Rn02_00279525 predicted 818
5 SASI_Rn02_00279526 predicted 1126
6 SASI_Rn02_00279527 predicted 1011
7 SASI_Rn02_00279528 predicted 891
8 SASI_Rn02_00279529 predicted 867
9 SASI_Rn02_00279530 predicted 1066
10 SASI_Rn02_00279531 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056014 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281770 predicted 1380
2 SASI_Rn02_00281771 predicted 1119
3 SASI_Rn02_00281772 predicted 1251
4 SASI_Rn02_00281773 predicted 1347
5 SASI_Rn02_00281774 predicted 1012
6 SASI_Rn02_00281775 predicted 1351
7 SASI_Rn02_00281776 predicted 1323
8 SASI_Rn02_00281777 predicted 1064
9 SASI_Rn02_00281778 predicted 981
10 SASI_Rn02_00281779 predicted 1141
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009767 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124832 predicted 652
2 SASI_Mm01_00124833 predicted 753
3 SASI_Mm01_00124834 predicted 623
4 SASI_Mm01_00124835 predicted 519
5 SASI_Mm01_00124836 predicted 964
6 SASI_Mm01_00124837 predicted 824
7 SASI_Mm01_00124838 predicted 448
8 SASI_Mm01_00124839 predicted 796
9 SASI_Mm01_00124840 predicted 931
10 SASI_Mm02_00316964 predicted 654
11 SASI_Mm01_00124841 predicted 940
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009767
VALIDATED
CHIC1 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich hydrophobic domain 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009767.1-357s1c1
Sequence:CCGGGATACCGAATTTCCGTCAGTTCTCGAGAACTGACGGAAATTCGGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009767.1-346s1c1
Sequence:CCGGGCAACAAGTTTGATACCGAATCTCGAGATTCGGTATCAAACTTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009767.1-189s1c1
Sequence:CCGGGAGGAAGAAGAGGAGGATGAACTCGAGTTCATCCTCCTCTTCTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009767.1-521s1c1
Sequence:CCGGGCCCGTGATTTGTCTCAACAACTCGAGTTGTTGAGACAAATCACGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009767.1-801s1c1
Sequence:CCGGCGCTGTGTTCAATTTATTCTTCTCGAGAAGAATAAATTGAACACAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009767.1-937s1c1
Sequence:CCGGGCAAACATATACCCGTATTTACTCGAGTAAATACGGGTATATGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_009767.1-448s1c1
Sequence:CCGGCTCTCCCTGTCAATGTGAAATCTCGAGATTTCACATTGACAGGGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_009767.1-323s1c1
Sequence:CCGGCCACATCACTGTGTTTGGATTCTCGAGAATCCAAACACAGTGATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_009767.1-399s1c1
Sequence:CCGGGAAGAATTTAAGACCAGCATTCTCGAGAATGCTGGTCTTAAATTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_009767.1-1018s1c1
Sequence:CCGGGAGCATGCTGCCTTATGATTTCTCGAGAAATCATAAGGCAGCATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009767
VALIDATED
CHIC1 MISSION shRNA shRNA Plasmid DNA
cysteine-rich hydrophobic domain 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009767.1-357s1c1
Sequence:CCGGGATACCGAATTTCCGTCAGTTCTCGAGAACTGACGGAAATTCGGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009767.1-346s1c1
Sequence:CCGGGCAACAAGTTTGATACCGAATCTCGAGATTCGGTATCAAACTTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009767.1-189s1c1
Sequence:CCGGGAGGAAGAAGAGGAGGATGAACTCGAGTTCATCCTCCTCTTCTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009767.1-521s1c1
Sequence:CCGGGCCCGTGATTTGTCTCAACAACTCGAGTTGTTGAGACAAATCACGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009767.1-801s1c1
Sequence:CCGGCGCTGTGTTCAATTTATTCTTCTCGAGAAGAATAAATTGAACACAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009767.1-937s1c1
Sequence:CCGGGCAAACATATACCCGTATTTACTCGAGTAAATACGGGTATATGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_009767.1-448s1c1
Sequence:CCGGCTCTCCCTGTCAATGTGAAATCTCGAGATTTCACATTGACAGGGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_009767.1-323s1c1
Sequence:CCGGCCACATCACTGTGTTTGGATTCTCGAGAATCCAAACACAGTGATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_009767.1-399s1c1
Sequence:CCGGGAAGAATTTAAGACCAGCATTCTCGAGAATGCTGGTCTTAAATTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_009767.1-1018s1c1
Sequence:CCGGGAGCATGCTGCCTTATGATTTCTCGAGAAATCATAAGGCAGCATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009767
VALIDATED
CHIC1 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich hydrophobic domain 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009767.1-357s1c1
Sequence:CCGGGATACCGAATTTCCGTCAGTTCTCGAGAACTGACGGAAATTCGGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009767.1-346s1c1
Sequence:CCGGGCAACAAGTTTGATACCGAATCTCGAGATTCGGTATCAAACTTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009767.1-189s1c1
Sequence:CCGGGAGGAAGAAGAGGAGGATGAACTCGAGTTCATCCTCCTCTTCTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009767.1-521s1c1
Sequence:CCGGGCCCGTGATTTGTCTCAACAACTCGAGTTGTTGAGACAAATCACGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009767.1-801s1c1
Sequence:CCGGCGCTGTGTTCAATTTATTCTTCTCGAGAAGAATAAATTGAACACAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009767.1-937s1c1
Sequence:CCGGGCAAACATATACCCGTATTTACTCGAGTAAATACGGGTATATGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_009767.1-448s1c1
Sequence:CCGGCTCTCCCTGTCAATGTGAAATCTCGAGATTTCACATTGACAGGGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_009767.1-323s1c1
Sequence:CCGGCCACATCACTGTGTTTGGATTCTCGAGAATCCAAACACAGTGATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_009767.1-399s1c1
Sequence:CCGGGAAGAATTTAAGACCAGCATTCTCGAGAATGCTGGTCTTAAATTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_009767.1-1018s1c1
Sequence:CCGGGAGCATGCTGCCTTATGATTTCTCGAGAAATCATAAGGCAGCATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039840
VALIDATED
CHIC1 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich hydrophobic domain 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000281545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039840.2-5008s21c1
Sequence:CCGGCCGACTGGCTGACGTGTTAATCTCGAGATTAACACGTCAGCCAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039840.2-369s21c1
Sequence:CCGGGAGGAGCATCTGCGGAGATATCTCGAGATATCTCCGCAGATGCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039840.2-731s21c1
Sequence:CCGGGAAATGTGAAACTAGCAATATCTCGAGATATTGCTAGTTTCACATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039840.2-461s21c1
Sequence:CCGGTGAATTTCCCTCCGTTCTAACCTCGAGGTTAGAACGGAGGGAAATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039840
VALIDATED
CHIC1 MISSION shRNA shRNA Plasmid DNA
cysteine-rich hydrophobic domain 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000281545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039840.2-5008s21c1
Sequence:CCGGCCGACTGGCTGACGTGTTAATCTCGAGATTAACACGTCAGCCAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039840.2-369s21c1
Sequence:CCGGGAGGAGCATCTGCGGAGATATCTCGAGATATCTCCGCAGATGCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039840.2-731s21c1
Sequence:CCGGGAAATGTGAAACTAGCAATATCTCGAGATATTGCTAGTTTCACATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039840.2-461s21c1
Sequence:CCGGTGAATTTCCCTCCGTTCTAACCTCGAGGTTAGAACGGAGGGAAATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039840
VALIDATED
CHIC1 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich hydrophobic domain 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000281545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039840.2-5008s21c1
Sequence:CCGGCCGACTGGCTGACGTGTTAATCTCGAGATTAACACGTCAGCCAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039840.2-369s21c1
Sequence:CCGGGAGGAGCATCTGCGGAGATATCTCGAGATATCTCCGCAGATGCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039840.2-731s21c1
Sequence:CCGGGAAATGTGAAACTAGCAATATCTCGAGATATTGCTAGTTTCACATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039840.2-461s21c1
Sequence:CCGGTGAATTTCCCTCCGTTCTAACCTCGAGGTTAGAACGGAGGGAAATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)