EMAIL THIS PAGE TO A FRIEND

CHIC2

cysteine-rich hydrophobic domain 2

83 Gene Product Result for
Synonyms: BTL
UniProtKB ID: Q9UKJ5, B2R639
Gene ID:
Human(26511) Summary: This gene encodes a member of the CHIC family of proteins. The encoded protein contains a cysteine-rich hydrophobic (CHIC) motif, and is localized to vesicular structures and the plasma membrane. This gene is associated with some cases of acute myeloid leukemia. [provided by RefSeq, Jul 2008]
Mouse(74277) cysteine-rich hydrophobic domain 2
Rat(83835) cysteine-rich hydrophobic domain 2
naked mole-rat(101698737) cysteine-rich hydrophobic domain 2
domestic guinea pig(100725660) cysteine-rich hydrophobic domain 2
sheep(101105753) cysteine-rich hydrophobic domain 2
Zebrafish(394095) cysteine-rich hydrophobic domain 2
chicken(422751) cysteine-rich hydrophobic domain 2
cow(615190) cysteine-rich hydrophobic domain 2
domestic cat(101091277) cysteine-rich hydrophobic domain 2
dog(611250) cysteine-rich hydrophobic domain 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012110 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012110 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012110 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028850 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028850 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028850 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012110 Rosetta Predictions human pricing
NM_001105736 Rosetta Predictions rat pricing
NM_028850 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187576 predicted 655
2 SASI_Hs01_00187577 predicted 511
3 SASI_Hs01_00187578 predicted 539
4 SASI_Hs01_00187579 predicted 609
5 SASI_Hs01_00187580 predicted 444
6 SASI_Hs01_00187581 predicted 696
7 SASI_Hs01_00187582 predicted 542
8 SASI_Hs01_00187583 predicted 658
9 SASI_Hs01_00187584 predicted 605
10 SASI_Hs01_00187585 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105736 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212026 predicted 562
2 SASI_Rn02_00212027 predicted 598
3 SASI_Rn02_00212028 predicted 386
4 SASI_Rn02_00212029 predicted 783
5 SASI_Rn02_00212030 predicted 757
6 SASI_Rn02_00212031 predicted 416
7 SASI_Rn02_00212032 predicted 490
8 SASI_Rn02_00212033 predicted 390
9 SASI_Rn02_00212034 predicted 469
10 SASI_Rn02_00212035 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028850 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093912 predicted 557
2 SASI_Mm02_00334512 predicted 844
3 SASI_Mm01_00093913 predicted 547
4 SASI_Mm01_00093914 predicted 618
5 SASI_Mm01_00093915 predicted 660
6 SASI_Mm01_00093916 predicted 520
7 SASI_Mm01_00093917 predicted 768
8 SASI_Mm01_00093918 predicted 852
9 SASI_Mm01_00093919 predicted 813
10 SASI_Mm01_00093920 predicted 451
11 SASI_Mm01_00093921 predicted 656
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012110
VALIDATED
CHIC2 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich hydrophobic domain 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_012110.2-528s21c1
Sequence:CCGGCAGAGTTAACAGTTGTCTTAACTCGAGTTAAGACAACTGTTAACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012110.2-495s21c1
Sequence:CCGGAGTAGCTCCTGAAGAATTTAACTCGAGTTAAATTCTTCAGGAGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012110.2-967s21c1
Sequence:CCGGCGCATGTTCTAAGTGTGCATTCTCGAGAATGCACACTTAGAACATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012110.2-805s21c1
Sequence:CCGGTTTCGACCAGATTAGCATTTACTCGAGTAAATGCTAATCTGGTCGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_012110.2-424s21c1
Sequence:CCGGTCCGGTCACGTCACCGTATTTCTCGAGAAATACGGTGACGTGACCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_012110.2-658s21c1
Sequence:CCGGAGATCGATTGAGAAGTTATTACTCGAGTAATAACTTCTCAATCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012110.2-967s1c1
Sequence:CCGGCGCATGTTCTAAGTGTGCATTCTCGAGAATGCACACTTAGAACATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012110.2-559s1c1
Sequence:CCGGCCTGTTAATGTACGTTGGCTACTCGAGTAGCCAACGTACATTAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_012110.2-627s1c1
Sequence:CCGGGCCAGTTATTTGCCTCAGTAACTCGAGTTACTGAGGCAAATAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012110.2-745s1c1
Sequence:CCGGGAAACGAATAACATGATGGAACTCGAGTTCCATCATGTTATTCGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012110.2-602s1c1
Sequence:CCGGGCTGCACATTAGGTTGCAGTACTCGAGTACTGCAACCTAATGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012110
VALIDATED
CHIC2 MISSION shRNA shRNA Plasmid DNA
cysteine-rich hydrophobic domain 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_012110.2-528s21c1
Sequence:CCGGCAGAGTTAACAGTTGTCTTAACTCGAGTTAAGACAACTGTTAACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012110.2-495s21c1
Sequence:CCGGAGTAGCTCCTGAAGAATTTAACTCGAGTTAAATTCTTCAGGAGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012110.2-967s21c1
Sequence:CCGGCGCATGTTCTAAGTGTGCATTCTCGAGAATGCACACTTAGAACATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012110.2-805s21c1
Sequence:CCGGTTTCGACCAGATTAGCATTTACTCGAGTAAATGCTAATCTGGTCGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_012110.2-424s21c1
Sequence:CCGGTCCGGTCACGTCACCGTATTTCTCGAGAAATACGGTGACGTGACCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_012110.2-658s21c1
Sequence:CCGGAGATCGATTGAGAAGTTATTACTCGAGTAATAACTTCTCAATCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012110.2-967s1c1
Sequence:CCGGCGCATGTTCTAAGTGTGCATTCTCGAGAATGCACACTTAGAACATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012110.2-559s1c1
Sequence:CCGGCCTGTTAATGTACGTTGGCTACTCGAGTAGCCAACGTACATTAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_012110.2-627s1c1
Sequence:CCGGGCCAGTTATTTGCCTCAGTAACTCGAGTTACTGAGGCAAATAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012110.2-745s1c1
Sequence:CCGGGAAACGAATAACATGATGGAACTCGAGTTCCATCATGTTATTCGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012110.2-602s1c1
Sequence:CCGGGCTGCACATTAGGTTGCAGTACTCGAGTACTGCAACCTAATGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012110
VALIDATED
CHIC2 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich hydrophobic domain 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_012110.2-528s21c1
Sequence:CCGGCAGAGTTAACAGTTGTCTTAACTCGAGTTAAGACAACTGTTAACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012110.2-495s21c1
Sequence:CCGGAGTAGCTCCTGAAGAATTTAACTCGAGTTAAATTCTTCAGGAGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012110.2-967s21c1
Sequence:CCGGCGCATGTTCTAAGTGTGCATTCTCGAGAATGCACACTTAGAACATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012110.2-805s21c1
Sequence:CCGGTTTCGACCAGATTAGCATTTACTCGAGTAAATGCTAATCTGGTCGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_012110.2-424s21c1
Sequence:CCGGTCCGGTCACGTCACCGTATTTCTCGAGAAATACGGTGACGTGACCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_012110.2-658s21c1
Sequence:CCGGAGATCGATTGAGAAGTTATTACTCGAGTAATAACTTCTCAATCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012110.2-967s1c1
Sequence:CCGGCGCATGTTCTAAGTGTGCATTCTCGAGAATGCACACTTAGAACATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012110.2-559s1c1
Sequence:CCGGCCTGTTAATGTACGTTGGCTACTCGAGTAGCCAACGTACATTAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_012110.2-627s1c1
Sequence:CCGGGCCAGTTATTTGCCTCAGTAACTCGAGTTACTGAGGCAAATAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012110.2-745s1c1
Sequence:CCGGGAAACGAATAACATGATGGAACTCGAGTTCCATCATGTTATTCGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012110.2-602s1c1
Sequence:CCGGGCTGCACATTAGGTTGCAGTACTCGAGTACTGCAACCTAATGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028850
CHIC2 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich hydrophobic domain 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028850.4-703s21c1
Sequence:CCGGGTTATACCACAAGCTGTGCTTCTCGAGAAGCACAGCTTGTGGTATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028850.4-446s21c1
Sequence:CCGGGTATTTGGACTGAGCAACAAACTCGAGTTTGTTGCTCAGTCCAAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028850.4-555s1c1
Sequence:CCGGGGAAGAATCTTCCTGTTAATGCTCGAGCATTAACAGGAAGATTCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028850.4-816s1c1
Sequence:CCGGGACCAGATTAGCATTTGCTTTCTCGAGAAAGCAAATGCTAATCTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028850.4-745s21c1
Sequence:CCGGGAAATGTGAAACGAACAACATCTCGAGATGTTGTTCGTTTCACATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028850.4-770s21c1
Sequence:CCGGGAATATGTCATCCTCATAGAACTCGAGTTCTATGAGGATGACATATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193693    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028850.1-852s1c1
Sequence:CCGGCCAAGTGTGTTGTCTTTCCAACTCGAGTTGGAAAGACAACACACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193579    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028850.1-965s1c1
Sequence:CCGGGCATGTTCTATGTGTGCATATCTCGAGATATGCACACATAGAACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028850.1-703s1c1
Sequence:CCGGGTTATACCACAAGCTGTGCTTCTCGAGAAGCACAGCTTGTGGTATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028850.1-752s1c1
Sequence:CCGGGAAACGAACAACATGATGGAACTCGAGTTCCATCATGTTGTTCGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028850.1-446s1c1
Sequence:CCGGGTATTTGGACTGAGCAACAAACTCGAGTTTGTTGCTCAGTCCAAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028850.1-745s1c1
Sequence:CCGGGAAATGTGAAACGAACAACATCTCGAGATGTTGTTCGTTTCACATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028850.1-770s1c1
Sequence:CCGGGAATATGTCATCCTCATAGAACTCGAGTTCTATGAGGATGACATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028850
CHIC2 MISSION shRNA shRNA Plasmid DNA
cysteine-rich hydrophobic domain 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028850.4-703s21c1
Sequence:CCGGGTTATACCACAAGCTGTGCTTCTCGAGAAGCACAGCTTGTGGTATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028850.4-446s21c1
Sequence:CCGGGTATTTGGACTGAGCAACAAACTCGAGTTTGTTGCTCAGTCCAAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028850.4-555s1c1
Sequence:CCGGGGAAGAATCTTCCTGTTAATGCTCGAGCATTAACAGGAAGATTCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028850.4-816s1c1
Sequence:CCGGGACCAGATTAGCATTTGCTTTCTCGAGAAAGCAAATGCTAATCTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028850.4-745s21c1
Sequence:CCGGGAAATGTGAAACGAACAACATCTCGAGATGTTGTTCGTTTCACATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028850.4-770s21c1
Sequence:CCGGGAATATGTCATCCTCATAGAACTCGAGTTCTATGAGGATGACATATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193693    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028850.1-852s1c1
Sequence:CCGGCCAAGTGTGTTGTCTTTCCAACTCGAGTTGGAAAGACAACACACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193579    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028850.1-965s1c1
Sequence:CCGGGCATGTTCTATGTGTGCATATCTCGAGATATGCACACATAGAACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028850.1-703s1c1
Sequence:CCGGGTTATACCACAAGCTGTGCTTCTCGAGAAGCACAGCTTGTGGTATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028850.1-752s1c1
Sequence:CCGGGAAACGAACAACATGATGGAACTCGAGTTCCATCATGTTGTTCGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028850.1-446s1c1
Sequence:CCGGGTATTTGGACTGAGCAACAAACTCGAGTTTGTTGCTCAGTCCAAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028850.1-745s1c1
Sequence:CCGGGAAATGTGAAACGAACAACATCTCGAGATGTTGTTCGTTTCACATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028850.1-770s1c1
Sequence:CCGGGAATATGTCATCCTCATAGAACTCGAGTTCTATGAGGATGACATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028850
CHIC2 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich hydrophobic domain 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028850.4-703s21c1
Sequence:CCGGGTTATACCACAAGCTGTGCTTCTCGAGAAGCACAGCTTGTGGTATAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028850.4-446s21c1
Sequence:CCGGGTATTTGGACTGAGCAACAAACTCGAGTTTGTTGCTCAGTCCAAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028850.4-555s1c1
Sequence:CCGGGGAAGAATCTTCCTGTTAATGCTCGAGCATTAACAGGAAGATTCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028850.4-816s1c1
Sequence:CCGGGACCAGATTAGCATTTGCTTTCTCGAGAAAGCAAATGCTAATCTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028850.4-745s21c1
Sequence:CCGGGAAATGTGAAACGAACAACATCTCGAGATGTTGTTCGTTTCACATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028850.4-770s21c1
Sequence:CCGGGAATATGTCATCCTCATAGAACTCGAGTTCTATGAGGATGACATATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193693    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028850.1-852s1c1
Sequence:CCGGCCAAGTGTGTTGTCTTTCCAACTCGAGTTGGAAAGACAACACACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193579    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028850.1-965s1c1
Sequence:CCGGGCATGTTCTATGTGTGCATATCTCGAGATATGCACACATAGAACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028850.1-703s1c1
Sequence:CCGGGTTATACCACAAGCTGTGCTTCTCGAGAAGCACAGCTTGTGGTATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028850.1-752s1c1
Sequence:CCGGGAAACGAACAACATGATGGAACTCGAGTTCCATCATGTTGTTCGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028850.1-446s1c1
Sequence:CCGGGTATTTGGACTGAGCAACAAACTCGAGTTTGTTGCTCAGTCCAAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028850.1-745s1c1
Sequence:CCGGGAAATGTGAAACGAACAACATCTCGAGATGTTGTTCGTTTCACATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028850.1-770s1c1
Sequence:CCGGGAATATGTCATCCTCATAGAACTCGAGTTCTATGAGGATGACATATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)