EMAIL THIS PAGE TO A FRIEND

CHKA

choline kinase alpha

121 Gene Product Result for
Synonyms: CHK CK CKI EK
UniProtKB ID: P35790, Q8NE29
Gene ID:
Human(1119) Summary: The major pathway for the biosynthesis of phosphatidylcholine occurs via the CDP-choline pathway. The protein encoded by this gene is the initial enzyme in the sequence and may play a regulatory role. The encoded protein also catalyzes the phosphorylation of ethanolamine. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(12660) choline kinase alpha
Rat(29194) choline kinase alpha
Zebrafish(558499) choline kinase alpha
chicken(423112) choline kinase alpha
dog(476002) choline kinase alpha
cow(514865) choline kinase alpha
Horse(100059839) choline kinase alpha
domestic cat(101083967) choline kinase alpha
sheep(101113448) choline kinase alpha
domestic guinea pig(100713089) choline kinase alpha
naked mole-rat(101720091) choline kinase alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001277 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001277 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001277 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013490 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013490 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013490 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001277 Rosetta Predictions human pricing
NM_212469 Rosetta Predictions human pricing
NM_017127 Rosetta Predictions rat pricing
NM_001025566 Rosetta Predictions mouse pricing
NM_013490 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001277 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061531 predicted 1075
2 SASI_Hs01_00061533 predicted 1264
3 SASI_Hs01_00061534 predicted 1189
4 SASI_Hs01_00061535 predicted 1137
5 SASI_Hs01_00061536 predicted 1230
6 SASI_Hs01_00061537 predicted 1430
7 SASI_Hs01_00061538 predicted 1073
8 SASI_Hs02_00331497 predicted 1245
9 SASI_Hs01_00061539 predicted 1495
10 SASI_Hs01_00061540 predicted 1493
11 SASI_Hs01_00061532 predicted 1035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044545 predicted 1018
2 SASI_Hs01_00044547 predicted 1203
3 SASI_Hs01_00044548 predicted 1136
4 SASI_Hs01_00044549 predicted 1087
5 SASI_Hs01_00044550 predicted 1185
6 SASI_Hs01_00044551 predicted 1375
7 SASI_Hs01_00044552 predicted 1024
8 SASI_Hs02_00374191 predicted 1189
9 SASI_Hs01_00044553 predicted 1435
10 SASI_Hs01_00044554 predicted 1434
11 SASI_Hs01_00044546 predicted 981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065470 predicted 1012
2 SASI_Rn01_00065471 predicted 971
3 SASI_Rn01_00065472 predicted 958
4 SASI_Rn01_00065473 predicted 1169
5 SASI_Rn01_00065474 predicted 886
6 SASI_Rn02_00261366 predicted 1448
7 SASI_Rn01_00065475 predicted 1225
8 SASI_Rn01_00065476 predicted 1236
9 SASI_Rn01_00065477 predicted 1399
10 SASI_Rn01_00065478 predicted 962
11 SASI_Rn01_00065479 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140918 predicted 899
2 SASI_Mm01_00140919 predicted 818
3 SASI_Mm01_00140920 predicted 932
4 SASI_Mm01_00140921 predicted 1261
5 SASI_Mm01_00140922 predicted 1244
6 SASI_Mm01_00140923 predicted 781
7 SASI_Mm01_00140924 predicted 1117
8 SASI_Mm01_00140925 predicted 842
9 SASI_Mm01_00140926 predicted 1116
10 SASI_Mm01_00140927 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013490 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134900 predicted 1294
2 SASI_Mm01_00134901 predicted 881
3 SASI_Mm01_00134902 predicted 1017
4 SASI_Mm01_00134903 predicted 1490
5 SASI_Mm01_00134904 predicted 1055
6 SASI_Mm01_00134905 predicted 773
7 SASI_Mm01_00134907 predicted 1117
8 SASI_Mm01_00134908 predicted 1282
9 SASI_Mm01_00134909 predicted 1332
10 SASI_Mm02_00322130 predicted 1149
11 SASI_Mm01_00134906 predicted 1223
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001277
VALIDATED
CHKA MISSION shRNA Bacterial Glycerol Stock
choline kinase alpha
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001277.1-1557s1c1
Sequence:CCGGGCGACGTTTATTTCATCTCTTCTCGAGAAGAGATGAAATAAACGTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001277.1-1306s1c1
Sequence:CCGGGCCAAGATTTCATCTATTGAACTCGAGTTCAATAGATGAAATCTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001277.1-843s1c1
Sequence:CCGGGCTCCACAAATTGCTCAGTTACTCGAGTAACTGAGCAATTTGTGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001277.1-660s1c1
Sequence:CCGGGCGATTAGATACTGAAGAATTCTCGAGAATTCTTCAGTATCTAATCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001277.1-1136s1c1
Sequence:CCGGCCAAGAAACAACAGCTCCATTCTCGAGAATGGAGCTGTTGTTTCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001277.2-877s1c1
Sequence:CCGGGCCAGATATTTCTGCAGAAATCTCGAGATTTCTGCAGAAATATCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196676    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001277.2-1930s1c1
Sequence:CCGGGCAGGTACTTTGGTTAATGTTCTCGAGAACATTAACCAAAGTACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381454    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_001277.2-1921s21c1
Sequence:GTACCGGGTGTTACTTGCAGGTACTTTGCTCGAGCAAAGTACCTGCAAGTAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001277.2-670s21c1
Sequence:GTACCGGGCAGATGAGGTCCTGTAATAACTCGAGTTATTACAGGACCTCATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001277.2-648s21c1
Sequence:CCGGTGCGGCTGTATGGAGCGATTTCTCGAGAAATCGCTCCATACAGCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001277.2-1540s21c1
Sequence:CCGGAGCAAGGTTTGATGCCTATTTCTCGAGAAATAGGCATCAAACCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001277.2-1206s21c1
Sequence:CCGGTCGAATACAGCAGTTACAATTCTCGAGAATTGTAACTGCTGTATTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001277.2-1720s21c1
Sequence:CCGGTGATACTAAAGACGGTATTAACTCGAGTTAATACCGTCTTTAGTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001277.2-743s21c1
Sequence:CCGGATGGTTCTGGAGAGCGTTATGCTCGAGCATAACGCTCTCCAGAACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001277.2-1302s21c1
Sequence:GTACCGGGAGCAAACATCCGGAAGTATCCTCGAGGATACTTCCGGATGTTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001277
VALIDATED
CHKA MISSION shRNA shRNA Plasmid DNA
choline kinase alpha
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001277.1-1557s1c1
Sequence:CCGGGCGACGTTTATTTCATCTCTTCTCGAGAAGAGATGAAATAAACGTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001277.1-1306s1c1
Sequence:CCGGGCCAAGATTTCATCTATTGAACTCGAGTTCAATAGATGAAATCTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001277.1-843s1c1
Sequence:CCGGGCTCCACAAATTGCTCAGTTACTCGAGTAACTGAGCAATTTGTGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001277.1-660s1c1
Sequence:CCGGGCGATTAGATACTGAAGAATTCTCGAGAATTCTTCAGTATCTAATCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001277.1-1136s1c1
Sequence:CCGGCCAAGAAACAACAGCTCCATTCTCGAGAATGGAGCTGTTGTTTCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001277.2-877s1c1
Sequence:CCGGGCCAGATATTTCTGCAGAAATCTCGAGATTTCTGCAGAAATATCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196676    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001277.2-1930s1c1
Sequence:CCGGGCAGGTACTTTGGTTAATGTTCTCGAGAACATTAACCAAAGTACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381454    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_001277.2-1921s21c1
Sequence:GTACCGGGTGTTACTTGCAGGTACTTTGCTCGAGCAAAGTACCTGCAAGTAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001277.2-670s21c1
Sequence:GTACCGGGCAGATGAGGTCCTGTAATAACTCGAGTTATTACAGGACCTCATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001277.2-648s21c1
Sequence:CCGGTGCGGCTGTATGGAGCGATTTCTCGAGAAATCGCTCCATACAGCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001277.2-1540s21c1
Sequence:CCGGAGCAAGGTTTGATGCCTATTTCTCGAGAAATAGGCATCAAACCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001277.2-1206s21c1
Sequence:CCGGTCGAATACAGCAGTTACAATTCTCGAGAATTGTAACTGCTGTATTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001277.2-1720s21c1
Sequence:CCGGTGATACTAAAGACGGTATTAACTCGAGTTAATACCGTCTTTAGTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001277.2-743s21c1
Sequence:CCGGATGGTTCTGGAGAGCGTTATGCTCGAGCATAACGCTCTCCAGAACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001277.2-1302s21c1
Sequence:GTACCGGGAGCAAACATCCGGAAGTATCCTCGAGGATACTTCCGGATGTTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001277
VALIDATED
CHKA MISSION shRNA Lentiviral Transduction Particles
choline kinase alpha
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001277.1-1557s1c1
Sequence:CCGGGCGACGTTTATTTCATCTCTTCTCGAGAAGAGATGAAATAAACGTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001277.1-1306s1c1
Sequence:CCGGGCCAAGATTTCATCTATTGAACTCGAGTTCAATAGATGAAATCTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001277.1-843s1c1
Sequence:CCGGGCTCCACAAATTGCTCAGTTACTCGAGTAACTGAGCAATTTGTGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001277.1-660s1c1
Sequence:CCGGGCGATTAGATACTGAAGAATTCTCGAGAATTCTTCAGTATCTAATCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001277.1-1136s1c1
Sequence:CCGGCCAAGAAACAACAGCTCCATTCTCGAGAATGGAGCTGTTGTTTCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001277.2-877s1c1
Sequence:CCGGGCCAGATATTTCTGCAGAAATCTCGAGATTTCTGCAGAAATATCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196676    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001277.2-1930s1c1
Sequence:CCGGGCAGGTACTTTGGTTAATGTTCTCGAGAACATTAACCAAAGTACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381454    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_001277.2-1921s21c1
Sequence:GTACCGGGTGTTACTTGCAGGTACTTTGCTCGAGCAAAGTACCTGCAAGTAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001277.2-670s21c1
Sequence:GTACCGGGCAGATGAGGTCCTGTAATAACTCGAGTTATTACAGGACCTCATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001277.2-648s21c1
Sequence:CCGGTGCGGCTGTATGGAGCGATTTCTCGAGAAATCGCTCCATACAGCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001277.2-1540s21c1
Sequence:CCGGAGCAAGGTTTGATGCCTATTTCTCGAGAAATAGGCATCAAACCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001277.2-1206s21c1
Sequence:CCGGTCGAATACAGCAGTTACAATTCTCGAGAATTGTAACTGCTGTATTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001277.2-1720s21c1
Sequence:CCGGTGATACTAAAGACGGTATTAACTCGAGTTAATACCGTCTTTAGTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001277.2-743s21c1
Sequence:CCGGATGGTTCTGGAGAGCGTTATGCTCGAGCATAACGCTCTCCAGAACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001277.2-1302s21c1
Sequence:GTACCGGGAGCAAACATCCGGAAGTATCCTCGAGGATACTTCCGGATGTTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013490
VALIDATED
CHKA MISSION shRNA Bacterial Glycerol Stock
choline kinase alpha
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013490.1-816s1c1
Sequence:CCGGGCCATTCAATAAGGAACCAAACTCGAGTTTGGTTCCTTATTGAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013490.1-928s1c1
Sequence:CCGGCTCTCTTACAACCTGCCTCTTCTCGAGAAGAGGCAGGTTGTAAGAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013490.1-748s1c1
Sequence:CCGGGAGTTACGTTTACCAGATATTCTCGAGAATATCTGGTAAACGTAACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013490.1-1396s1c1
Sequence:CCGGGAATTTGGGTACATGGAATATCTCGAGATATTCCATGTACCCAAATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013490.1-1238s1c1
Sequence:CCGGGTTACTTGACTACATTCCAAACTCGAGTTTGGAATGTAGTCAAGTAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013490.3-1231s21c1
Sequence:GTACCGGGAGTACAGCAGTTACAATTACCTCGAGGTAATTGTAACTGCTGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013490.3-1849s21c1
Sequence:CCGGATAGCTCAGAACCCGCCTAAACTCGAGTTTAGGCGGGTTCTGAGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013490.3-1280s21c1
Sequence:CCGGGTGAATGGATGTATGATTATACTCGAGTATAATCATACATCCATTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013490.3-1002s21c1
Sequence:CCGGATACCTGAATCAAGTACTAAGCTCGAGCTTAGTACTTGATTCAGGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013490.3-890s21c1
Sequence:CCGGAGTTACGTTTACCAGATATTTCTCGAGAAATATCTGGTAAACGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013490.3-1953s21c1
Sequence:CCGGAGTGCTGACTTAGGATATTAACTCGAGTTAATATCCTAAGTCAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013490.3-1205s21c1
Sequence:CCGGGGCGGAAGCTGATGCTTATTGCTCGAGCAATAAGCATCAGCTTCCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013490.3-843s21c1
Sequence:CCGGAGGCCGACTGGAGCAGTTTATCTCGAGATAAACTGCTCCAGTCGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013490
VALIDATED
CHKA MISSION shRNA shRNA Plasmid DNA
choline kinase alpha
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013490.1-816s1c1
Sequence:CCGGGCCATTCAATAAGGAACCAAACTCGAGTTTGGTTCCTTATTGAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013490.1-928s1c1
Sequence:CCGGCTCTCTTACAACCTGCCTCTTCTCGAGAAGAGGCAGGTTGTAAGAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013490.1-748s1c1
Sequence:CCGGGAGTTACGTTTACCAGATATTCTCGAGAATATCTGGTAAACGTAACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013490.1-1396s1c1
Sequence:CCGGGAATTTGGGTACATGGAATATCTCGAGATATTCCATGTACCCAAATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013490.1-1238s1c1
Sequence:CCGGGTTACTTGACTACATTCCAAACTCGAGTTTGGAATGTAGTCAAGTAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013490.3-1231s21c1
Sequence:GTACCGGGAGTACAGCAGTTACAATTACCTCGAGGTAATTGTAACTGCTGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013490.3-1849s21c1
Sequence:CCGGATAGCTCAGAACCCGCCTAAACTCGAGTTTAGGCGGGTTCTGAGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013490.3-1280s21c1
Sequence:CCGGGTGAATGGATGTATGATTATACTCGAGTATAATCATACATCCATTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013490.3-1002s21c1
Sequence:CCGGATACCTGAATCAAGTACTAAGCTCGAGCTTAGTACTTGATTCAGGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013490.3-890s21c1
Sequence:CCGGAGTTACGTTTACCAGATATTTCTCGAGAAATATCTGGTAAACGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013490.3-1953s21c1
Sequence:CCGGAGTGCTGACTTAGGATATTAACTCGAGTTAATATCCTAAGTCAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013490.3-1205s21c1
Sequence:CCGGGGCGGAAGCTGATGCTTATTGCTCGAGCAATAAGCATCAGCTTCCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013490.3-843s21c1
Sequence:CCGGAGGCCGACTGGAGCAGTTTATCTCGAGATAAACTGCTCCAGTCGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013490
VALIDATED
CHKA MISSION shRNA Lentiviral Transduction Particles
choline kinase alpha
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013490.1-816s1c1
Sequence:CCGGGCCATTCAATAAGGAACCAAACTCGAGTTTGGTTCCTTATTGAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013490.1-928s1c1
Sequence:CCGGCTCTCTTACAACCTGCCTCTTCTCGAGAAGAGGCAGGTTGTAAGAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013490.1-748s1c1
Sequence:CCGGGAGTTACGTTTACCAGATATTCTCGAGAATATCTGGTAAACGTAACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013490.1-1396s1c1
Sequence:CCGGGAATTTGGGTACATGGAATATCTCGAGATATTCCATGTACCCAAATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013490.1-1238s1c1
Sequence:CCGGGTTACTTGACTACATTCCAAACTCGAGTTTGGAATGTAGTCAAGTAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013490.3-1231s21c1
Sequence:GTACCGGGAGTACAGCAGTTACAATTACCTCGAGGTAATTGTAACTGCTGTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013490.3-1849s21c1
Sequence:CCGGATAGCTCAGAACCCGCCTAAACTCGAGTTTAGGCGGGTTCTGAGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013490.3-1280s21c1
Sequence:CCGGGTGAATGGATGTATGATTATACTCGAGTATAATCATACATCCATTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013490.3-1002s21c1
Sequence:CCGGATACCTGAATCAAGTACTAAGCTCGAGCTTAGTACTTGATTCAGGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013490.3-890s21c1
Sequence:CCGGAGTTACGTTTACCAGATATTTCTCGAGAAATATCTGGTAAACGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013490.3-1953s21c1
Sequence:CCGGAGTGCTGACTTAGGATATTAACTCGAGTTAATATCCTAAGTCAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013490.3-1205s21c1
Sequence:CCGGGGCGGAAGCTGATGCTTATTGCTCGAGCAATAAGCATCAGCTTCCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013490.3-843s21c1
Sequence:CCGGAGGCCGACTGGAGCAGTTTATCTCGAGATAAACTGCTCCAGTCGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)