EMAIL THIS PAGE TO A FRIEND

CHMP2B

charged multivesicular body protein 2B

91 Gene Product Result for
Synonyms: ALS17 CHMP2.5 DMT1 VPS2-2 VPS2B
UniProtKB ID: Q9UQN3, B4DJG8, Q53HC7, Q9Y4U6
Gene ID:
Human(25978) Summary: This gene encodes a component of the heteromeric ESCRT-III complex (Endosomal Sorting Complex Required for Transport III) that functions in the recycling or degradation of cell surface receptors. ESCRT-III functions in the concentration and invagination of ubiquitinated endosomal cargos into intralumenal vesicles. The protein encoded by this gene is found as a monomer in the cytosol or as an oligomer in ESCRT-III complexes on endosomal membranes. It is expressed in neurons of all major regions of the brain. Mutations in this gene result in one form of familial frontotemporal lobar degeneration. [provided by RefSeq, Jul 2008]
Mouse(68942) charged multivesicular body protein 2B
Rat(363720) charged multivesicular body protein 2B
fruit fly(38599) Charged multivesicular body protein 2b
chicken(418461) charged multivesicular body protein 2B
dog(487675) charged multivesicular body protein 2B
cow(615954) charged multivesicular body protein 2B
domestic cat(101099491) charged multivesicular body protein 2B
sheep(101121224) charged multivesicular body protein 2B
domestic guinea pig(100734811) charged multivesicular body protein 2B
naked mole-rat(101717020) charged multivesicular body protein 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014043 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014043 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014043 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026879 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026879 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026879 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014043 Rosetta Predictions human pricing
XM_001063932 Rosetta Predictions rat pricing
XM_343995 Rosetta Predictions rat pricing
NM_026879 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345032 predicted 552
2 SASI_Hs02_00345033 predicted 693
3 SASI_Hs02_00345034 predicted 619
4 SASI_Hs02_00345035 predicted 552
5 SASI_Hs02_00345036 predicted 506
6 SASI_Hs01_00133872 predicted 441
7 SASI_Hs02_00345037 predicted 628
8 SASI_Hs01_00133873 predicted 855
9 SASI_Hs01_00133874 predicted 403
10 SASI_Hs01_00133875 predicted 310
11 SASI_Hs01_00133870 predicted 376
12 SASI_Hs01_00133871 predicted 346
13 SASI_Hs01_00133876 predicted 745
14 SASI_Hs01_00133877 predicted 160
15 SASI_Hs01_00133878 predicted 699
16 SASI_Hs01_00133879 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063932 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308775 predicted 1309
2 SASI_Rn02_00308776 predicted 505
3 SASI_Rn02_00308777 predicted 885
4 SASI_Rn02_00308778 predicted 1096
5 SASI_Rn02_00308779 predicted 1148
6 SASI_Rn02_00308780 predicted 1250
7 SASI_Rn02_00308781 predicted 1340
8 SASI_Rn02_00308782 predicted 861
9 SASI_Rn02_00308783 predicted 947
10 SASI_Rn02_00308784 predicted 1401
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343995 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396637 predicted 1115
2 SASI_Rn02_00396638 predicted 499
3 SASI_Rn02_00396639 predicted 1147
4 SASI_Rn02_00396640 predicted 901
5 SASI_Rn02_00396641 predicted 954
6 SASI_Rn02_00396642 predicted 1055
7 SASI_Rn02_00396643 predicted 1201
8 SASI_Rn02_00396644 predicted 213
9 SASI_Rn02_00396645 predicted 337
10 SASI_Rn02_00396646 predicted 1190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026879 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029360 predicted 600
2 SASI_Mm01_00029361 predicted 331
3 SASI_Mm01_00029362 predicted 543
4 SASI_Mm01_00029363 predicted 311
5 SASI_Mm01_00029365 predicted 843
6 SASI_Mm01_00029366 predicted 335
7 SASI_Mm01_00029367 predicted 928
8 SASI_Mm01_00029368 predicted 395
9 SASI_Mm01_00029369 predicted 838
10 SASI_Mm02_00331133 predicted 766
11 SASI_Mm01_00029364 predicted 707
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014043
VALIDATED
CHMP2B MISSION shRNA Bacterial Glycerol Stock
charged multivesicular body protein 2B
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014043.2-636s1c1
Sequence:CCGGGCTTACCATCTGCCTCTACTTCTCGAGAAGTAGAGGCAGATGGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014043.2-173s1c1
Sequence:CCGGGCAGCTTTAGAGAAACAAGAACTCGAGTTCTTGTTTCTCTAAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014043.2-633s1c1
Sequence:CCGGGAAGCTTACCATCTGCCTCTACTCGAGTAGAGGCAGATGGTAAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014043.2-1317s1c1
Sequence:CCGGGCCTTAAATAGCACAGACCTACTCGAGTAGGTCTGTGCTATTTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014043.2-1306s1c1
Sequence:CCGGGCTTGACACCTGCCTTAAATACTCGAGTATTTAAGGCAGGTGTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014043.2-407s1c1
Sequence:CCGGGCAGTTAACAAGAAGATGGATCTCGAGATCCATCTTCTTGTTAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014043.3-691s21c1
Sequence:CCGGATACACTTGATGACATCTTTGCTCGAGCAAAGATGTCATCAAGTGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014043.3-304s21c1
Sequence:CCGGAGGAACAGAATCGAGAGTTACCTCGAGGTAACTCTCGATTCTGTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014043.3-357s21c1
Sequence:CCGGGCAGCTTTAGAGAAACAAGAACTCGAGTTCTTGTTTCTCTAAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014043.3-1501s21c1
Sequence:CCGGGCCTTAAATAGCACAGACCTACTCGAGTAGGTCTGTGCTATTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014043.3-820s21c1
Sequence:CCGGGCTTACCATCTGCCTCTACTTCTCGAGAAGTAGAGGCAGATGGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014043.3-506s21c1
Sequence:CCGGTACTTCTATGTCTACACAAACCTCGAGGTTTGTGTAGACATAGAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014043.3-881s21c1
Sequence:CCGGCAAGGCTTTAGGAGTAGATTACTCGAGTAATCTACTCCTAAAGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014043.3-326s21c1
Sequence:CCGGAGGTACACAGAGGGCTATAATCTCGAGATTATAGCCCTCTGTGTACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014043
VALIDATED
CHMP2B MISSION shRNA shRNA Plasmid DNA
charged multivesicular body protein 2B
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014043.2-636s1c1
Sequence:CCGGGCTTACCATCTGCCTCTACTTCTCGAGAAGTAGAGGCAGATGGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014043.2-173s1c1
Sequence:CCGGGCAGCTTTAGAGAAACAAGAACTCGAGTTCTTGTTTCTCTAAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014043.2-633s1c1
Sequence:CCGGGAAGCTTACCATCTGCCTCTACTCGAGTAGAGGCAGATGGTAAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014043.2-1317s1c1
Sequence:CCGGGCCTTAAATAGCACAGACCTACTCGAGTAGGTCTGTGCTATTTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014043.2-1306s1c1
Sequence:CCGGGCTTGACACCTGCCTTAAATACTCGAGTATTTAAGGCAGGTGTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014043.2-407s1c1
Sequence:CCGGGCAGTTAACAAGAAGATGGATCTCGAGATCCATCTTCTTGTTAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014043.3-691s21c1
Sequence:CCGGATACACTTGATGACATCTTTGCTCGAGCAAAGATGTCATCAAGTGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014043.3-304s21c1
Sequence:CCGGAGGAACAGAATCGAGAGTTACCTCGAGGTAACTCTCGATTCTGTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014043.3-357s21c1
Sequence:CCGGGCAGCTTTAGAGAAACAAGAACTCGAGTTCTTGTTTCTCTAAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014043.3-1501s21c1
Sequence:CCGGGCCTTAAATAGCACAGACCTACTCGAGTAGGTCTGTGCTATTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014043.3-820s21c1
Sequence:CCGGGCTTACCATCTGCCTCTACTTCTCGAGAAGTAGAGGCAGATGGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014043.3-506s21c1
Sequence:CCGGTACTTCTATGTCTACACAAACCTCGAGGTTTGTGTAGACATAGAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014043.3-881s21c1
Sequence:CCGGCAAGGCTTTAGGAGTAGATTACTCGAGTAATCTACTCCTAAAGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014043.3-326s21c1
Sequence:CCGGAGGTACACAGAGGGCTATAATCTCGAGATTATAGCCCTCTGTGTACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014043
VALIDATED
CHMP2B MISSION shRNA Lentiviral Transduction Particles
charged multivesicular body protein 2B
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014043.2-636s1c1
Sequence:CCGGGCTTACCATCTGCCTCTACTTCTCGAGAAGTAGAGGCAGATGGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014043.2-173s1c1
Sequence:CCGGGCAGCTTTAGAGAAACAAGAACTCGAGTTCTTGTTTCTCTAAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014043.2-633s1c1
Sequence:CCGGGAAGCTTACCATCTGCCTCTACTCGAGTAGAGGCAGATGGTAAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014043.2-1317s1c1
Sequence:CCGGGCCTTAAATAGCACAGACCTACTCGAGTAGGTCTGTGCTATTTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014043.2-1306s1c1
Sequence:CCGGGCTTGACACCTGCCTTAAATACTCGAGTATTTAAGGCAGGTGTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014043.2-407s1c1
Sequence:CCGGGCAGTTAACAAGAAGATGGATCTCGAGATCCATCTTCTTGTTAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014043.3-691s21c1
Sequence:CCGGATACACTTGATGACATCTTTGCTCGAGCAAAGATGTCATCAAGTGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014043.3-304s21c1
Sequence:CCGGAGGAACAGAATCGAGAGTTACCTCGAGGTAACTCTCGATTCTGTTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014043.3-357s21c1
Sequence:CCGGGCAGCTTTAGAGAAACAAGAACTCGAGTTCTTGTTTCTCTAAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014043.3-1501s21c1
Sequence:CCGGGCCTTAAATAGCACAGACCTACTCGAGTAGGTCTGTGCTATTTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014043.3-820s21c1
Sequence:CCGGGCTTACCATCTGCCTCTACTTCTCGAGAAGTAGAGGCAGATGGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014043.3-506s21c1
Sequence:CCGGTACTTCTATGTCTACACAAACCTCGAGGTTTGTGTAGACATAGAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014043.3-881s21c1
Sequence:CCGGCAAGGCTTTAGGAGTAGATTACTCGAGTAATCTACTCCTAAAGCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014043.3-326s21c1
Sequence:CCGGAGGTACACAGAGGGCTATAATCTCGAGATTATAGCCCTCTGTGTACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026879
VALIDATED
CHMP2B MISSION shRNA Bacterial Glycerol Stock
charged multivesicular body protein 2B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026879.1-446s1c1
Sequence:CCGGGTCCACACAAACGAAAGTGATCTCGAGATCACTTTCGTTTGTGTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191824    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026879.1-1425s1c1
Sequence:CCGGGCCTTAAATAGCACGAACATACTCGAGTATGTTCGTGCTATTTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026879.1-789s1c1
Sequence:CCGGGATGAAGAGATTGAACGTCAACTCGAGTTGACGTTCAATCTCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026879.2-405s21c1
Sequence:CCGGGACAAGAACGTTCGCTGTAAGCTCGAGCTTACAGCGAACGTTCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026879.2-333s21c1
Sequence:CCGGGATGGCCAAGATTGGTAATAACTCGAGTTATTACCAATCTTGGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026879.2-763s21c1
Sequence:CCGGTCCACTTCAAAGGCTACAATTCTCGAGAATTGTAGCCTTTGAAGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026879.2-1158s21c1
Sequence:CCGGGCCATTAGGCGTCAACGTAAACTCGAGTTTACGTTGACGCCTAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026879.2-599s21c1
Sequence:CCGGTGACTGAAGAAATGATCAATGCTCGAGCATTGATCATTTCTTCAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026879
VALIDATED
CHMP2B MISSION shRNA shRNA Plasmid DNA
charged multivesicular body protein 2B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026879.1-446s1c1
Sequence:CCGGGTCCACACAAACGAAAGTGATCTCGAGATCACTTTCGTTTGTGTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191824    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026879.1-1425s1c1
Sequence:CCGGGCCTTAAATAGCACGAACATACTCGAGTATGTTCGTGCTATTTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026879.1-789s1c1
Sequence:CCGGGATGAAGAGATTGAACGTCAACTCGAGTTGACGTTCAATCTCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026879.2-405s21c1
Sequence:CCGGGACAAGAACGTTCGCTGTAAGCTCGAGCTTACAGCGAACGTTCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026879.2-333s21c1
Sequence:CCGGGATGGCCAAGATTGGTAATAACTCGAGTTATTACCAATCTTGGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026879.2-763s21c1
Sequence:CCGGTCCACTTCAAAGGCTACAATTCTCGAGAATTGTAGCCTTTGAAGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026879.2-1158s21c1
Sequence:CCGGGCCATTAGGCGTCAACGTAAACTCGAGTTTACGTTGACGCCTAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026879.2-599s21c1
Sequence:CCGGTGACTGAAGAAATGATCAATGCTCGAGCATTGATCATTTCTTCAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026879
VALIDATED
CHMP2B MISSION shRNA Lentiviral Transduction Particles
charged multivesicular body protein 2B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026879.1-446s1c1
Sequence:CCGGGTCCACACAAACGAAAGTGATCTCGAGATCACTTTCGTTTGTGTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191824    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026879.1-1425s1c1
Sequence:CCGGGCCTTAAATAGCACGAACATACTCGAGTATGTTCGTGCTATTTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026879.1-789s1c1
Sequence:CCGGGATGAAGAGATTGAACGTCAACTCGAGTTGACGTTCAATCTCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026879.2-405s21c1
Sequence:CCGGGACAAGAACGTTCGCTGTAAGCTCGAGCTTACAGCGAACGTTCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026879.2-333s21c1
Sequence:CCGGGATGGCCAAGATTGGTAATAACTCGAGTTATTACCAATCTTGGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026879.2-763s21c1
Sequence:CCGGTCCACTTCAAAGGCTACAATTCTCGAGAATTGTAGCCTTTGAAGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026879.2-1158s21c1
Sequence:CCGGGCCATTAGGCGTCAACGTAAACTCGAGTTTACGTTGACGCCTAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026879.2-599s21c1
Sequence:CCGGTGACTGAAGAAATGATCAATGCTCGAGCATTGATCATTTCTTCAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)