EMAIL THIS PAGE TO A FRIEND

CHRNA1

cholinergic receptor, nicotinic, alpha 1 (muscle)

84 Gene Product Result for
Synonyms: ACHRA ACHRD CHRNA CMS2A FCCMS SCCMS
UniProtKB ID: P02708, B4DRV6, D3DPE8
Gene ID:
Human(1134) Summary: The muscle acetylcholine receptor consiststs of 5 subunits of 4 different types: 2 alpha subunits and 1 each of the beta, gamma, and delta subunits. This gene encodes an alpha subunit that plays a role in acetlycholine binding/channel gating. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Nov 2012]
Mouse(11435) cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)
Rat(79557) cholinergic receptor, nicotinic, alpha 1 (muscle)
Zebrafish(30725) cholinergic receptor, nicotinic, alpha polypeptide 1
dog(403757) cholinergic receptor, nicotinic, alpha 1 (muscle)
cow(338070) cholinergic receptor, nicotinic, alpha 1 (muscle)
chicken(395608) cholinergic receptor, nicotinic, alpha 1 (muscle)
sheep(101110120) cholinergic receptor, nicotinic, alpha 1 (muscle)
domestic guinea pig(100729588) cholinergic receptor, nicotinic, alpha 1 (muscle)
naked mole-rat(101715747) cholinergic receptor, nicotinic, alpha 1 (muscle)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000079 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000079 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000079 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007389 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007389 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007389 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061451 MISSION® esiRNA esiRNA human CHRNA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000079 Rosetta Predictions human pricing
NM_001039523 Rosetta Predictions human pricing
NM_024485 Rosetta Predictions rat pricing
NM_007389 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211991 predicted 517
2 SASI_Hs01_00211992 predicted 1562
3 SASI_Hs01_00211993 predicted 1064
4 SASI_Hs01_00211994 predicted 1151
5 SASI_Hs01_00211995 predicted 1573
6 SASI_Hs01_00211996 predicted 1520
7 SASI_Hs01_00211997 predicted 1533
8 SASI_Hs01_00211998 predicted 1636
9 SASI_Hs01_00211999 predicted 1310
10 SASI_Hs01_00212000 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236661 predicted 588
2 SASI_Hs01_00236662 predicted 1634
3 SASI_Hs01_00236663 predicted 1138
4 SASI_Hs01_00236664 predicted 1228
5 SASI_Hs01_00236665 predicted 1649
6 SASI_Hs01_00236666 predicted 1597
7 SASI_Hs01_00236667 predicted 1599
8 SASI_Hs01_00236668 predicted 1712
9 SASI_Hs01_00236669 predicted 1381
10 SASI_Hs01_00236670 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024485 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264014 predicted 410
2 SASI_Rn01_00039775 predicted 970
3 SASI_Rn01_00039776 predicted 1065
4 SASI_Rn01_00039777 predicted 1201
5 SASI_Rn02_00264015 predicted 496
6 SASI_Rn01_00039779 predicted 246
7 SASI_Rn01_00039780 predicted 263
8 SASI_Rn01_00039781 predicted 1237
9 SASI_Rn01_00039782 predicted 879
10 SASI_Rn01_00039783 predicted 1499
11 SASI_Rn01_00039778 predicted 593
12 SASI_Rn01_00039784 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007389 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186145 predicted 373
2 SASI_Mm02_00311495 predicted 573
3 SASI_Mm01_00186146 predicted 461
4 SASI_Mm01_00186147 predicted 1029
5 SASI_Mm01_00186148 predicted 1461
6 SASI_Mm01_00186149 predicted 230
7 SASI_Mm01_00186150 predicted 474
8 SASI_Mm01_00186151 predicted 1246
9 SASI_Mm01_00186153 predicted 206
10 SASI_Mm01_00186154 predicted 856
11 SASI_Mm01_00186152 predicted 268
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000079
CHRNA1 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, alpha 1 (muscle)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000079.1-785s1c1
Sequence:CCGGCCTTCTTAACTGGCCTGGTATCTCGAGATACCAGGCCAGTTAAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000079.1-368s1c1
Sequence:CCGGGCCCAGACCTTGTTCTCTATACTCGAGTATAGAGAACAAGGTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000079.1-259s1c1
Sequence:CCGGACAACCAATGTGCGTCTGAAACTCGAGTTTCAGACGCACATTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000079.1-1315s1c1
Sequence:CCGGGCAATGGTGATGGACCACATACTCGAGTATGTGGTCCATCACCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000079.1-1059s1c1
Sequence:CCGGCGACACTATCCCAAATATCATCTCGAGATGATATTTGGGATAGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000079.3-1172s21c1
Sequence:CCGGACATTGATATCTCTGACATTTCTCGAGAAATGTCAGAGATATCAATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000079.3-1419s21c1
Sequence:CCGGAGGTCGACTCATTGAATTAAACTCGAGTTTAATTCAATGAGTCGACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000079
CHRNA1 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, alpha 1 (muscle)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000079.1-785s1c1
Sequence:CCGGCCTTCTTAACTGGCCTGGTATCTCGAGATACCAGGCCAGTTAAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000079.1-368s1c1
Sequence:CCGGGCCCAGACCTTGTTCTCTATACTCGAGTATAGAGAACAAGGTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000079.1-259s1c1
Sequence:CCGGACAACCAATGTGCGTCTGAAACTCGAGTTTCAGACGCACATTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000079.1-1315s1c1
Sequence:CCGGGCAATGGTGATGGACCACATACTCGAGTATGTGGTCCATCACCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000079.1-1059s1c1
Sequence:CCGGCGACACTATCCCAAATATCATCTCGAGATGATATTTGGGATAGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000079.3-1172s21c1
Sequence:CCGGACATTGATATCTCTGACATTTCTCGAGAAATGTCAGAGATATCAATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000079.3-1419s21c1
Sequence:CCGGAGGTCGACTCATTGAATTAAACTCGAGTTTAATTCAATGAGTCGACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000079
CHRNA1 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, alpha 1 (muscle)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000079.1-785s1c1
Sequence:CCGGCCTTCTTAACTGGCCTGGTATCTCGAGATACCAGGCCAGTTAAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000079.1-368s1c1
Sequence:CCGGGCCCAGACCTTGTTCTCTATACTCGAGTATAGAGAACAAGGTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000079.1-259s1c1
Sequence:CCGGACAACCAATGTGCGTCTGAAACTCGAGTTTCAGACGCACATTGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000079.1-1315s1c1
Sequence:CCGGGCAATGGTGATGGACCACATACTCGAGTATGTGGTCCATCACCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000079.1-1059s1c1
Sequence:CCGGCGACACTATCCCAAATATCATCTCGAGATGATATTTGGGATAGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000079.3-1172s21c1
Sequence:CCGGACATTGATATCTCTGACATTTCTCGAGAAATGTCAGAGATATCAATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000079.3-1419s21c1
Sequence:CCGGAGGTCGACTCATTGAATTAAACTCGAGTTTAATTCAATGAGTCGACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007389
CHRNA1 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, alpha 1 (muscle)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007389.2-2461s1c1
Sequence:CCGGGCGATCACATACAAATAGTATCTCGAGATACTATTTGTATGTGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007389.2-1365s1c1
Sequence:CCGGCGGCTCATTGAGTTACATCAACTCGAGTTGATGTAACTCAATGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007389.2-1031s1c1
Sequence:CCGGCGACACTATCCCAAACATCATCTCGAGATGATGTTTGGGATAGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007389.2-230s1c1
Sequence:CCGGGACAACCAATGTACGTCTGAACTCGAGTTCAGACGTACATTGGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007389.2-231s1c1
Sequence:CCGGACAACCAATGTACGTCTGAAACTCGAGTTTCAGACGTACATTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007389
CHRNA1 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, alpha 1 (muscle)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007389.2-2461s1c1
Sequence:CCGGGCGATCACATACAAATAGTATCTCGAGATACTATTTGTATGTGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007389.2-1365s1c1
Sequence:CCGGCGGCTCATTGAGTTACATCAACTCGAGTTGATGTAACTCAATGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007389.2-1031s1c1
Sequence:CCGGCGACACTATCCCAAACATCATCTCGAGATGATGTTTGGGATAGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007389.2-230s1c1
Sequence:CCGGGACAACCAATGTACGTCTGAACTCGAGTTCAGACGTACATTGGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007389.2-231s1c1
Sequence:CCGGACAACCAATGTACGTCTGAAACTCGAGTTTCAGACGTACATTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007389
CHRNA1 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, alpha 1 (muscle)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007389.2-2461s1c1
Sequence:CCGGGCGATCACATACAAATAGTATCTCGAGATACTATTTGTATGTGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007389.2-1365s1c1
Sequence:CCGGCGGCTCATTGAGTTACATCAACTCGAGTTGATGTAACTCAATGAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007389.2-1031s1c1
Sequence:CCGGCGACACTATCCCAAACATCATCTCGAGATGATGTTTGGGATAGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007389.2-230s1c1
Sequence:CCGGGACAACCAATGTACGTCTGAACTCGAGTTCAGACGTACATTGGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007389.2-231s1c1
Sequence:CCGGACAACCAATGTACGTCTGAAACTCGAGTTTCAGACGTACATTGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)