EMAIL THIS PAGE TO A FRIEND

CHRNB2

cholinergic receptor, nicotinic, beta 2 (neuronal)

77 Gene Product Result for
Synonyms: EFNL3 nAChRB2
UniProtKB ID: P17787, Q9UEH9
Gene ID:
Human(1141) Summary: Neuronal acetylcholine receptors are homo- or heteropentameric complexes composed of homologous alpha and beta subunits. They belong to a superfamily of ligand-gated ion channels which allow the flow of sodium and potassium across the plasma membrane in response to ligands such as acetylcholine and nicotine. This gene encodes one of several beta subunits. Mutations in this gene are associated with autosomal dominant nocturnal frontal lobe epilepsy. [provided by RefSeq, Jul 2008]
Mouse(11444) cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)
Rat(54239) cholinergic receptor, nicotinic, beta 2 (neuronal)
chicken(395605) cholinergic receptor, nicotinic, beta 2 (neuronal)
dog(490443) cholinergic receptor, nicotinic, beta 2 (neuronal)
cow(517519) cholinergic receptor, nicotinic, beta 2 (neuronal)
domestic cat(101084932) cholinergic receptor, nicotinic, beta 2 (neuronal)
domestic guinea pig(100730761) cholinergic receptor, nicotinic, beta 2 (neuronal)
naked mole-rat(101704220) cholinergic receptor, nicotinic, beta 2 (neuronal)
sheep(101104117) cholinergic receptor, nicotinic, beta 2 (neuronal)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
N0540 Nicotinic Receptor, Neuronal human membrane suspension human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000748 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000748 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000748 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009602 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009602 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009602 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000748 Rosetta Predictions human pricing
NM_019297 Rosetta Predictions rat pricing
NM_009602 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124257 predicted 1046
2 SASI_Hs01_00124258 predicted 533
3 SASI_Hs01_00124259 predicted 440
4 SASI_Hs01_00124260 predicted 715
5 SASI_Hs01_00124261 predicted 910
6 SASI_Hs01_00124262 predicted 850
7 SASI_Hs01_00124263 predicted 1595
8 SASI_Hs01_00124264 predicted 927
9 SASI_Hs01_00124265 predicted 1686
10 SASI_Hs01_00124266 predicted 1259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262256 predicted 359
2 SASI_Rn01_00052218 predicted 313
3 SASI_Rn01_00052219 predicted 290
4 SASI_Rn01_00052220 predicted 837
5 SASI_Rn01_00052221 predicted 560
6 SASI_Rn01_00052222 predicted 1679
7 SASI_Rn01_00052223 predicted 343
8 SASI_Rn01_00052224 predicted 528
9 SASI_Rn01_00052225 predicted 1340
10 SASI_Rn01_00052226 predicted 1639
11 SASI_Rn01_00052227 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009602 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080209 predicted 586
2 SASI_Mm01_00080210 predicted 559
3 SASI_Mm01_00080211 predicted 1334
4 SASI_Mm01_00080212 predicted 338
5 SASI_Mm01_00080213 predicted 721
6 SASI_Mm01_00080214 predicted 518
7 SASI_Mm01_00080215 predicted 1672
8 SASI_Mm01_00080216 predicted 543
9 SASI_Mm01_00080217 predicted 357
10 SASI_Mm01_00080218 predicted 1689
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000748
CHRNB2 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, beta 2 (neuronal)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000748.2-663s21c1
Sequence:CCGGCAATGCCGTGGTCTCCTATGACTCGAGTCATAGGAGACCACGGCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000748.2-611s21c1
Sequence:CCGGATGTGGTCCTGTACAACAATGCTCGAGCATTGTTGTACAGGACCACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000748.2-1677s21c1
Sequence:CCGGCTTTGGCACCATCGGCATGTTCTCGAGAACATGCCGATGGTGCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000748.2-1996s21c1
Sequence:CCGGTTGTACCAGCCCAGGCAATAGCTCGAGCTATTGCCTGGGCTGGTACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000748.1-927s1c1
Sequence:CCGGCGTGGACATCACGTATGACTTCTCGAGAAGTCATACGTGATGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000748.1-723s1c1
Sequence:CCGGCGCATGCAAGATTGAAGTAAACTCGAGTTTACTTCAATCTTGCATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000748.1-556s1c1
Sequence:CCGGGAGTTTGACAACATGAAGAAACTCGAGTTTCTTCATGTTGTCAAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000748.1-1647s1c1
Sequence:CCGGCTTCCTCTGGATCTTTGTCTTCTCGAGAAGACAAAGATCCAGAGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000748
CHRNB2 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, beta 2 (neuronal)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000748.2-663s21c1
Sequence:CCGGCAATGCCGTGGTCTCCTATGACTCGAGTCATAGGAGACCACGGCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000748.2-611s21c1
Sequence:CCGGATGTGGTCCTGTACAACAATGCTCGAGCATTGTTGTACAGGACCACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000748.2-1677s21c1
Sequence:CCGGCTTTGGCACCATCGGCATGTTCTCGAGAACATGCCGATGGTGCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000748.2-1996s21c1
Sequence:CCGGTTGTACCAGCCCAGGCAATAGCTCGAGCTATTGCCTGGGCTGGTACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000748.1-927s1c1
Sequence:CCGGCGTGGACATCACGTATGACTTCTCGAGAAGTCATACGTGATGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000748.1-723s1c1
Sequence:CCGGCGCATGCAAGATTGAAGTAAACTCGAGTTTACTTCAATCTTGCATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000748.1-556s1c1
Sequence:CCGGGAGTTTGACAACATGAAGAAACTCGAGTTTCTTCATGTTGTCAAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000748.1-1647s1c1
Sequence:CCGGCTTCCTCTGGATCTTTGTCTTCTCGAGAAGACAAAGATCCAGAGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000748
CHRNB2 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, beta 2 (neuronal)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000748.2-663s21c1
Sequence:CCGGCAATGCCGTGGTCTCCTATGACTCGAGTCATAGGAGACCACGGCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000748.2-611s21c1
Sequence:CCGGATGTGGTCCTGTACAACAATGCTCGAGCATTGTTGTACAGGACCACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000748.2-1677s21c1
Sequence:CCGGCTTTGGCACCATCGGCATGTTCTCGAGAACATGCCGATGGTGCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000748.2-1996s21c1
Sequence:CCGGTTGTACCAGCCCAGGCAATAGCTCGAGCTATTGCCTGGGCTGGTACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000748.1-927s1c1
Sequence:CCGGCGTGGACATCACGTATGACTTCTCGAGAAGTCATACGTGATGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000748.1-723s1c1
Sequence:CCGGCGCATGCAAGATTGAAGTAAACTCGAGTTTACTTCAATCTTGCATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000748.1-556s1c1
Sequence:CCGGGAGTTTGACAACATGAAGAAACTCGAGTTTCTTCATGTTGTCAAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000748.1-1647s1c1
Sequence:CCGGCTTCCTCTGGATCTTTGTCTTCTCGAGAAGACAAAGATCCAGAGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009602
CHRNB2 MISSION shRNA Bacterial Glycerol Stock
cholinergic receptor, nicotinic, beta 2 (neuronal)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009602.3-4068s1c1
Sequence:CCGGCGGATCAGATTGGTAGATATACTCGAGTATATCTACCAATCTGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009602.3-300s1c1
Sequence:CCGGCGCTATAACAAGCTGATCCGTCTCGAGACGGATCAGCTTGTTATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009602.3-556s1c1
Sequence:CCGGTGTACGAAGTCTCCTTCTATTCTCGAGAATAGAAGGAGACTTCGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009602.3-857s1c1
Sequence:CCGGCGACTTCATCATTCGTCGCAACTCGAGTTGCGACGAATGATGAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009602.3-1334s1c1
Sequence:CCGGCCCATGTACCTGCTTTGTCAACTCGAGTTGACAAAGCAGGTACATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009602
CHRNB2 MISSION shRNA shRNA Plasmid DNA
cholinergic receptor, nicotinic, beta 2 (neuronal)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009602.3-4068s1c1
Sequence:CCGGCGGATCAGATTGGTAGATATACTCGAGTATATCTACCAATCTGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009602.3-300s1c1
Sequence:CCGGCGCTATAACAAGCTGATCCGTCTCGAGACGGATCAGCTTGTTATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009602.3-556s1c1
Sequence:CCGGTGTACGAAGTCTCCTTCTATTCTCGAGAATAGAAGGAGACTTCGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009602.3-857s1c1
Sequence:CCGGCGACTTCATCATTCGTCGCAACTCGAGTTGCGACGAATGATGAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009602.3-1334s1c1
Sequence:CCGGCCCATGTACCTGCTTTGTCAACTCGAGTTGACAAAGCAGGTACATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009602
CHRNB2 MISSION shRNA Lentiviral Transduction Particles
cholinergic receptor, nicotinic, beta 2 (neuronal)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009602.3-4068s1c1
Sequence:CCGGCGGATCAGATTGGTAGATATACTCGAGTATATCTACCAATCTGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009602.3-300s1c1
Sequence:CCGGCGCTATAACAAGCTGATCCGTCTCGAGACGGATCAGCTTGTTATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009602.3-556s1c1
Sequence:CCGGTGTACGAAGTCTCCTTCTATTCTCGAGAATAGAAGGAGACTTCGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009602.3-857s1c1
Sequence:CCGGCGACTTCATCATTCGTCGCAACTCGAGTTGCGACGAATGATGAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009602.3-1334s1c1
Sequence:CCGGCCCATGTACCTGCTTTGTCAACTCGAGTTGACAAAGCAGGTACATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)