EMAIL THIS PAGE TO A FRIEND

CIDEB

cell death-inducing DFFA-like effector b

54 Gene Product Result for
UniProtKB ID: Q9UHD4, D3DS73, Q546V8, Q9NNW9
Gene ID:
Mouse(12684) cell death-inducing DNA fragmentation factor, alpha subunit-like effector B
Rat(364388) cell death-inducing DFFA-like effector b
naked mole-rat(101721091) cell death-inducing DFFA-like effector b
domestic guinea pig(100735296) cell death-inducing DFFA-like effector b
sheep(101113497) cell death-inducing DFFA-like effector b
Zebrafish(553467) cell death-inducing DFFA-like effector b
cow(528834) cell death-inducing DFFA-like effector b
domestic cat(101083268) cell death-inducing DFFA-like effector b
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS2319 Anti-CIDE-B (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS2321 Anti-CIDE-B (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS2091 Anti-CIDE-B (ab3) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
ELISA, western blot pricing
C8102 Anti-CIDE-B, C-Terminal antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
western blot pricing
SAB2103905 Anti-CIDEB antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA001272 Anti-CIDEB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4501201 Anti-CIDEB antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0027141M1 Monoclonal Anti-CIDEB antibody produced in mouse clone 2A10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1405032 Monoclonal Anti-CIDEB antibody produced in mouse clone 3H4, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014430 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014430 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014430 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009894 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009894 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009894 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014430 Rosetta Predictions human pricing
NM_001108869 Rosetta Predictions rat pricing
NM_009894 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193308 predicted 1527
2 SASI_Hs01_00193309 predicted 1951
3 SASI_Hs01_00193310 predicted 1323
4 SASI_Hs01_00193312 predicted 1163
5 SASI_Hs01_00193313 predicted 1967
6 SASI_Hs01_00193314 predicted 1511
7 SASI_Hs02_00345637 predicted 1319
8 SASI_Hs01_00193315 predicted 1611
9 SASI_Hs01_00193316 predicted 1392
10 SASI_Hs01_00193317 predicted 1158
11 SASI_Hs01_00193311 predicted 1343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108869 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242885 predicted 503
2 SASI_Rn02_00242886 predicted 258
3 SASI_Rn02_00242887 predicted 529
4 SASI_Rn02_00242888 predicted 394
5 SASI_Rn02_00242889 predicted 201
6 SASI_Rn02_00242890 predicted 651
7 SASI_Rn02_00242891 predicted 581
8 SASI_Rn02_00242892 predicted 519
9 SASI_Rn02_00242893 predicted 453
10 SASI_Rn02_00242894 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009894 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317394 predicted 572
2 SASI_Mm01_00145971 predicted 508
3 SASI_Mm01_00145973 predicted 231
4 SASI_Mm02_00317395 predicted 481
5 SASI_Mm01_00145974 predicted 556
6 SASI_Mm01_00145975 predicted 531
7 SASI_Mm01_00145976 predicted 770
8 SASI_Mm01_00145977 predicted 784
9 SASI_Mm01_00145978 predicted 841
10 SASI_Mm02_00317396 predicted 587
11 SASI_Mm01_00145972 predicted 885
12 SASI_Mm01_00145979 predicted 406
13 SASI_Mm01_00145980 predicted 576
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014430
CIDEB MISSION shRNA Bacterial Glycerol Stock
cell death-inducing DFFA-like effector b
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1630s1c1
Sequence:CCGGGAATGTCAAAGCCACATTCTACTCGAGTAGAATGTGGCTTTGACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1576s1c1
Sequence:CCGGCCGATTCACCTTTGACGTGTACTCGAGTACACGTCAAAGGTGAATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140001    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014430.1-2000s1c1
Sequence:CCGGGCCTCACATCCCAAGTCTATACTCGAGTATAGACTTGGGATGTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1209s1c1
Sequence:CCGGGTGACTTACTCAGGTCAGTATCTCGAGATACTGACCTGAGTAAGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1679s1c1
Sequence:CCGGCAAGGACTTGGCCCAAAGAAACTCGAGTTTCTTTGGGCCAAGTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1626s1c1
Sequence:CCGGGCCTGAATGTCAAAGCCACATCTCGAGATGTGGCTTTGACATTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1379s1c1
Sequence:CCGGCTACTGCTGAATGGAGTGCTACTCGAGTAGCACTCCATTCAGCAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014430.1-1976s1c1
Sequence:CCGGCGTGACAGAACCTTTCAGCATCTCGAGATGCTGAAAGGTTCTGTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1618s1c1
Sequence:CCGGCTTTGGCAGCCTGAATGTCAACTCGAGTTGACATTCAGGCTGCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1666s1c1
Sequence:CCGGGAGTTGTGACTTTCAAGGACTCTCGAGAGTCCTTGAAAGTCACAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1584s1c1
Sequence:CCGGCCTTTGACGTGTACAAGCAAACTCGAGTTTGCTTGTACACGTCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1690s1c1
Sequence:CCGGCCCAAAGAAAGTACTCAGGGACTCGAGTCCCTGAGTACTTTCTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1627s1c1
Sequence:CCGGCCTGAATGTCAAAGCCACATTCTCGAGAATGTGGCTTTGACATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014430
CIDEB MISSION shRNA shRNA Plasmid DNA
cell death-inducing DFFA-like effector b
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1630s1c1
Sequence:CCGGGAATGTCAAAGCCACATTCTACTCGAGTAGAATGTGGCTTTGACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1576s1c1
Sequence:CCGGCCGATTCACCTTTGACGTGTACTCGAGTACACGTCAAAGGTGAATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140001    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014430.1-2000s1c1
Sequence:CCGGGCCTCACATCCCAAGTCTATACTCGAGTATAGACTTGGGATGTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1209s1c1
Sequence:CCGGGTGACTTACTCAGGTCAGTATCTCGAGATACTGACCTGAGTAAGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1679s1c1
Sequence:CCGGCAAGGACTTGGCCCAAAGAAACTCGAGTTTCTTTGGGCCAAGTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1626s1c1
Sequence:CCGGGCCTGAATGTCAAAGCCACATCTCGAGATGTGGCTTTGACATTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1379s1c1
Sequence:CCGGCTACTGCTGAATGGAGTGCTACTCGAGTAGCACTCCATTCAGCAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014430.1-1976s1c1
Sequence:CCGGCGTGACAGAACCTTTCAGCATCTCGAGATGCTGAAAGGTTCTGTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1618s1c1
Sequence:CCGGCTTTGGCAGCCTGAATGTCAACTCGAGTTGACATTCAGGCTGCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1666s1c1
Sequence:CCGGGAGTTGTGACTTTCAAGGACTCTCGAGAGTCCTTGAAAGTCACAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1584s1c1
Sequence:CCGGCCTTTGACGTGTACAAGCAAACTCGAGTTTGCTTGTACACGTCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1690s1c1
Sequence:CCGGCCCAAAGAAAGTACTCAGGGACTCGAGTCCCTGAGTACTTTCTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1627s1c1
Sequence:CCGGCCTGAATGTCAAAGCCACATTCTCGAGAATGTGGCTTTGACATTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014430
CIDEB MISSION shRNA Lentiviral Transduction Particles
cell death-inducing DFFA-like effector b
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1630s1c1
Sequence:CCGGGAATGTCAAAGCCACATTCTACTCGAGTAGAATGTGGCTTTGACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1576s1c1
Sequence:CCGGCCGATTCACCTTTGACGTGTACTCGAGTACACGTCAAAGGTGAATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140001    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014430.1-2000s1c1
Sequence:CCGGGCCTCACATCCCAAGTCTATACTCGAGTATAGACTTGGGATGTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1209s1c1
Sequence:CCGGGTGACTTACTCAGGTCAGTATCTCGAGATACTGACCTGAGTAAGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1679s1c1
Sequence:CCGGCAAGGACTTGGCCCAAAGAAACTCGAGTTTCTTTGGGCCAAGTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1626s1c1
Sequence:CCGGGCCTGAATGTCAAAGCCACATCTCGAGATGTGGCTTTGACATTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1379s1c1
Sequence:CCGGCTACTGCTGAATGGAGTGCTACTCGAGTAGCACTCCATTCAGCAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014430.1-1976s1c1
Sequence:CCGGCGTGACAGAACCTTTCAGCATCTCGAGATGCTGAAAGGTTCTGTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1618s1c1
Sequence:CCGGCTTTGGCAGCCTGAATGTCAACTCGAGTTGACATTCAGGCTGCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1666s1c1
Sequence:CCGGGAGTTGTGACTTTCAAGGACTCTCGAGAGTCCTTGAAAGTCACAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1584s1c1
Sequence:CCGGCCTTTGACGTGTACAAGCAAACTCGAGTTTGCTTGTACACGTCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1690s1c1
Sequence:CCGGCCCAAAGAAAGTACTCAGGGACTCGAGTCCCTGAGTACTTTCTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014430.1-1627s1c1
Sequence:CCGGCCTGAATGTCAAAGCCACATTCTCGAGAATGTGGCTTTGACATTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009894
CIDEB MISSION shRNA Bacterial Glycerol Stock
cell death-inducing DFFA-like effector b
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009894.1-563s1c1
Sequence:CCGGGCCTCAACGTGAAAGCAACATCTCGAGATGTTGCTTTCACGTTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009894.1-886s1c1
Sequence:CCGGGCTGACTCCATCCTAACAGATCTCGAGATCTGTTAGGATGGAGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009894.1-521s1c1
Sequence:CCGGCCTTCGATGTGTACAAGCAAACTCGAGTTTGCTTGTACACATCGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009894.1-931s1c1
Sequence:CCGGCCTGTACATCTTCCTGAAGAACTCGAGTTCTTCAGGAAGATGTACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009894.1-156s1c1
Sequence:CCGGGCTAAGGTCAGTATCCACTGTCTCGAGACAGTGGATACTGACCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009894
CIDEB MISSION shRNA shRNA Plasmid DNA
cell death-inducing DFFA-like effector b
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009894.1-563s1c1
Sequence:CCGGGCCTCAACGTGAAAGCAACATCTCGAGATGTTGCTTTCACGTTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009894.1-886s1c1
Sequence:CCGGGCTGACTCCATCCTAACAGATCTCGAGATCTGTTAGGATGGAGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009894.1-521s1c1
Sequence:CCGGCCTTCGATGTGTACAAGCAAACTCGAGTTTGCTTGTACACATCGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009894.1-931s1c1
Sequence:CCGGCCTGTACATCTTCCTGAAGAACTCGAGTTCTTCAGGAAGATGTACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009894.1-156s1c1
Sequence:CCGGGCTAAGGTCAGTATCCACTGTCTCGAGACAGTGGATACTGACCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009894
CIDEB MISSION shRNA Lentiviral Transduction Particles
cell death-inducing DFFA-like effector b
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009894.1-563s1c1
Sequence:CCGGGCCTCAACGTGAAAGCAACATCTCGAGATGTTGCTTTCACGTTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009894.1-886s1c1
Sequence:CCGGGCTGACTCCATCCTAACAGATCTCGAGATCTGTTAGGATGGAGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009894.1-521s1c1
Sequence:CCGGCCTTCGATGTGTACAAGCAAACTCGAGTTTGCTTGTACACATCGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009894.1-931s1c1
Sequence:CCGGCCTGTACATCTTCCTGAAGAACTCGAGTTCTTCAGGAAGATGTACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009894.1-156s1c1
Sequence:CCGGGCTAAGGTCAGTATCCACTGTCTCGAGACAGTGGATACTGACCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)