EMAIL THIS PAGE TO A FRIEND

CILP2

cartilage intermediate layer protein 2

56 Gene Product Result for
Synonyms: CLIP-2
UniProtKB ID: Q8IUL8, Q6NV88, Q8N4A6, Q8WV21
Gene ID:
Mouse(68709) cartilage intermediate layer protein 2
Rat(306356) cartilage intermediate layer protein 2
naked mole-rat(101704122) cartilage intermediate layer protein 2
domestic guinea pig(100722238) cartilage intermediate layer protein 2
Zebrafish(557778) cartilage intermediate layer protein 2
cow(520750) cartilage intermediate layer protein 2
Horse(100071183) cartilage intermediate layer protein 2
domestic cat(101100702) cartilage intermediate layer protein 2
dog(484804) cartilage intermediate layer protein 2
chicken(430666) cartilage intermediate layer protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153221 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153221 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153221 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026818 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026818 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026818 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU213941 MISSION® esiRNA esiRNA targeting mouse Cilp2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153221 Rosetta Predictions human pricing
NM_001107307 Rosetta Predictions rat pricing
NM_026818 Rosetta Predictions mouse pricing
XM_146393 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100002 predicted 3158
2 SASI_Hs01_00100003 predicted 3302
3 SASI_Hs01_00100004 predicted 2118
4 SASI_Hs01_00100007 predicted 1245
5 SASI_Hs01_00100008 predicted 2789
6 SASI_Hs02_00367080 predicted 3701
7 SASI_Hs02_00367081 predicted 3459
8 SASI_Hs01_00100009 predicted 1726
9 SASI_Hs01_00100010 predicted 2635
10 SASI_Hs02_00367082 predicted 3869
11 SASI_Hs01_00100005 predicted 1396
12 SASI_Hs01_00100006 predicted 2083
13 SASI_Hs01_00100011 predicted 1699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107307 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227545 predicted 1453
2 SASI_Rn02_00227546 predicted 926
3 SASI_Rn02_00227547 predicted 981
4 SASI_Rn02_00227548 predicted 3502
5 SASI_Rn02_00227549 predicted 1427
6 SASI_Rn02_00227550 predicted 3737
7 SASI_Rn02_00227551 predicted 3598
8 SASI_Rn02_00227552 predicted 2647
9 SASI_Rn02_00227553 predicted 1539
10 SASI_Rn02_00227554 predicted 2505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026818 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330964 predicted 940
2 SASI_Mm02_00330965 predicted 2728
3 SASI_Mm02_00330966 predicted 3626
4 SASI_Mm02_00330967 predicted 2464
5 SASI_Mm02_00330968 predicted 3468
6 SASI_Mm02_00330969 predicted 3706
7 SASI_Mm02_00330970 predicted 3225
8 SASI_Mm02_00330971 predicted 364
9 SASI_Mm02_00330972 predicted 2581
10 SASI_Mm02_00330973 predicted 1393
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_146393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222874 predicted 947
2 SASI_Mm01_00222875 predicted 3548
3 SASI_Mm01_00222876 predicted 2738
4 SASI_Mm01_00222877 predicted 3636
5 SASI_Mm01_00222878 predicted 2473
6 SASI_Mm01_00222879 predicted 3466
7 SASI_Mm01_00222880 predicted 3715
8 SASI_Mm01_00222881 predicted 3229
9 SASI_Mm01_00222882 predicted 374
10 SASI_Mm01_00222883 predicted 2589
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153221
CILP2 MISSION shRNA Bacterial Glycerol Stock
cartilage intermediate layer protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153221.2-192s21c1
Sequence:CCGGTGGAAAGACGGTCCGTGTACACTCGAGTGTACACGGACCGTCTTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153221.2-3154s21c1
Sequence:CCGGCAACGGACTCCTTCGGGATTACTCGAGTAATCCCGAAGGAGTCCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153221.2-3707s21c1
Sequence:CCGGAGAGCATCCGATGGTAGAAACCTCGAGGTTTCTACCATCGGATGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153221.2-3850s21c1
Sequence:CCGGTCTGACTTCTCGTGCGTATTTCTCGAGAAATACGCACGAGAAGTCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153221.2-3902s21c1
Sequence:CCGGGTTCTGGCGTTTGGCACAAAGCTCGAGCTTTGTGCCAAACGCCAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153221.1-2867s1c1
Sequence:CCGGCTGCTTCCTCAAGGTGAAGATCTCGAGATCTTCACCTTGAGGAAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153221.1-2768s1c1
Sequence:CCGGCAAGTACGAGTACAACGTGGTCTCGAGACCACGTTGTACTCGTACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153221.1-974s1c1
Sequence:CCGGGAATGTGACTTTCTGCTGCAACTCGAGTTGCAGCAGAAAGTCACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153221.1-1019s1c1
Sequence:CCGGGAAATACTCCTGGTTCCACAACTCGAGTTGTGGAACCAGGAGTATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153221
CILP2 MISSION shRNA shRNA Plasmid DNA
cartilage intermediate layer protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153221.2-192s21c1
Sequence:CCGGTGGAAAGACGGTCCGTGTACACTCGAGTGTACACGGACCGTCTTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153221.2-3154s21c1
Sequence:CCGGCAACGGACTCCTTCGGGATTACTCGAGTAATCCCGAAGGAGTCCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153221.2-3707s21c1
Sequence:CCGGAGAGCATCCGATGGTAGAAACCTCGAGGTTTCTACCATCGGATGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153221.2-3850s21c1
Sequence:CCGGTCTGACTTCTCGTGCGTATTTCTCGAGAAATACGCACGAGAAGTCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153221.2-3902s21c1
Sequence:CCGGGTTCTGGCGTTTGGCACAAAGCTCGAGCTTTGTGCCAAACGCCAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153221.1-2867s1c1
Sequence:CCGGCTGCTTCCTCAAGGTGAAGATCTCGAGATCTTCACCTTGAGGAAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153221.1-2768s1c1
Sequence:CCGGCAAGTACGAGTACAACGTGGTCTCGAGACCACGTTGTACTCGTACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153221.1-974s1c1
Sequence:CCGGGAATGTGACTTTCTGCTGCAACTCGAGTTGCAGCAGAAAGTCACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153221.1-1019s1c1
Sequence:CCGGGAAATACTCCTGGTTCCACAACTCGAGTTGTGGAACCAGGAGTATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153221
CILP2 MISSION shRNA Lentiviral Transduction Particles
cartilage intermediate layer protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153221.2-192s21c1
Sequence:CCGGTGGAAAGACGGTCCGTGTACACTCGAGTGTACACGGACCGTCTTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153221.2-3154s21c1
Sequence:CCGGCAACGGACTCCTTCGGGATTACTCGAGTAATCCCGAAGGAGTCCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153221.2-3707s21c1
Sequence:CCGGAGAGCATCCGATGGTAGAAACCTCGAGGTTTCTACCATCGGATGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153221.2-3850s21c1
Sequence:CCGGTCTGACTTCTCGTGCGTATTTCTCGAGAAATACGCACGAGAAGTCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153221.2-3902s21c1
Sequence:CCGGGTTCTGGCGTTTGGCACAAAGCTCGAGCTTTGTGCCAAACGCCAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153221.1-2867s1c1
Sequence:CCGGCTGCTTCCTCAAGGTGAAGATCTCGAGATCTTCACCTTGAGGAAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153221.1-2768s1c1
Sequence:CCGGCAAGTACGAGTACAACGTGGTCTCGAGACCACGTTGTACTCGTACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153221.1-974s1c1
Sequence:CCGGGAATGTGACTTTCTGCTGCAACTCGAGTTGCAGCAGAAAGTCACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153221.1-1019s1c1
Sequence:CCGGGAAATACTCCTGGTTCCACAACTCGAGTTGTGGAACCAGGAGTATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026818
CILP2 MISSION shRNA Bacterial Glycerol Stock
cartilage intermediate layer protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026818.2-3263s21c1
Sequence:CCGGCCCACGTTTGGCCAAGGAAATCTCGAGATTTCCTTGGCCAAACGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026818.2-1954s21c1
Sequence:CCGGTGCGAACCTATGGCATGTTTGCTCGAGCAAACATGCCATAGGTTCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026818.2-949s21c1
Sequence:CCGGTTCGAGAGGCAGGTCAGAATGCTCGAGCATTCTGACCTGCCTCTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026818.2-3807s21c1
Sequence:CCGGTAGGTTCTGAGGTCGTATTTACTCGAGTAAATACGACCTCAGAACCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026818.2-994s21c1
Sequence:CCGGGGACACCCATGCCCAAGAAATCTCGAGATTTCTTGGGCATGGGTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026818
CILP2 MISSION shRNA shRNA Plasmid DNA
cartilage intermediate layer protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026818.2-3263s21c1
Sequence:CCGGCCCACGTTTGGCCAAGGAAATCTCGAGATTTCCTTGGCCAAACGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026818.2-1954s21c1
Sequence:CCGGTGCGAACCTATGGCATGTTTGCTCGAGCAAACATGCCATAGGTTCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026818.2-949s21c1
Sequence:CCGGTTCGAGAGGCAGGTCAGAATGCTCGAGCATTCTGACCTGCCTCTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026818.2-3807s21c1
Sequence:CCGGTAGGTTCTGAGGTCGTATTTACTCGAGTAAATACGACCTCAGAACCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026818.2-994s21c1
Sequence:CCGGGGACACCCATGCCCAAGAAATCTCGAGATTTCTTGGGCATGGGTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026818
CILP2 MISSION shRNA Lentiviral Transduction Particles
cartilage intermediate layer protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026818.2-3263s21c1
Sequence:CCGGCCCACGTTTGGCCAAGGAAATCTCGAGATTTCCTTGGCCAAACGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026818.2-1954s21c1
Sequence:CCGGTGCGAACCTATGGCATGTTTGCTCGAGCAAACATGCCATAGGTTCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026818.2-949s21c1
Sequence:CCGGTTCGAGAGGCAGGTCAGAATGCTCGAGCATTCTGACCTGCCTCTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026818.2-3807s21c1
Sequence:CCGGTAGGTTCTGAGGTCGTATTTACTCGAGTAAATACGACCTCAGAACCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026818.2-994s21c1
Sequence:CCGGGGACACCCATGCCCAAGAAATCTCGAGATTTCTTGGGCATGGGTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)