EMAIL THIS PAGE TO A FRIEND

CIRH1A

cirrhosis, autosomal recessive 1A (cirhin)

190 Gene Product Result for
Synonyms: CIRHIN NAIC TEX292 UTP4
Gene ID:
Human(84916) Summary: This gene encodes a WD40-repeat-containing protein that is localized to the nucleolus. Mutation of this gene causes North American Indian childhood cirrhosis, a severe intrahepatic cholestasis that results in transient neonatal jaundice, and progresses to periportal fibrosis and cirrhosis in childhood and adolescence. [provided by RefSeq, Jul 2008]
Mouse(21771) cirrhosis, autosomal recessive 1A (human)
Rat(291987) cirrhosis, autosomal recessive 1A (cirhin)
sheep(101120686) cirrhosis, autosomal recessive 1A (cirhin)
naked mole-rat(101717614) cirrhosis, autosomal recessive 1A (cirhin)
domestic guinea pig(100725393) cirrhosis, autosomal recessive 1A (cirhin)
Zebrafish(406571) cirrhosis, autosomal recessive 1A (cirhin)
dog(489738) cirrhosis, autosomal recessive 1A (cirhin)
cow(510315) cirrhosis, autosomal recessive 1A (cirhin)
Horse(100066965) cirrhosis, autosomal recessive 1A (cirhin)
domestic cat(101096526) cirrhosis, autosomal recessive 1A (cirhin)
chicken(769632) cirrhosis, autosomal recessive 1A (cirhin)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011574 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011574 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011574 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032830 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032830 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032830 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU093391 MISSION® esiRNA esiRNA human CIRH1A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032830 Rosetta Predictions human pricing
NM_001009640 Rosetta Predictions rat pricing
NM_011574 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115198 predicted 1099
2 SASI_Hs01_00115199 predicted 648
3 SASI_Hs01_00115200 predicted 620
4 SASI_Hs01_00115201 predicted 1227
5 SASI_Hs01_00115203 predicted 561
6 SASI_Hs01_00115204 predicted 1143
7 SASI_Hs01_00115205 predicted 1446
8 SASI_Hs02_00360421 predicted 1982
9 SASI_Hs01_00115206 predicted 332
10 SASI_Hs01_00115207 predicted 1962
11 SASI_Hs01_00115202 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009640 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056049 predicted 1409
2 SASI_Rn01_00056050 predicted 563
3 SASI_Rn02_00199660 predicted 385
4 SASI_Rn01_00056051 predicted 1834
5 SASI_Rn01_00056052 predicted 1557
6 SASI_Rn01_00056053 predicted 1456
7 SASI_Rn01_00056054 predicted 1280
8 SASI_Rn01_00056055 predicted 385
9 SASI_Rn01_00056056 predicted 310
10 SASI_Rn01_00056057 predicted 992
11 SASI_Rn01_00056058 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011574 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134688 predicted 786
2 SASI_Mm01_00134690 predicted 1595
3 SASI_Mm02_00320960 predicted 1890
4 SASI_Mm02_00320961 predicted 595
5 SASI_Mm01_00134691 predicted 1436
6 SASI_Mm02_00320962 predicted 597
7 SASI_Mm02_00320963 predicted 587
8 SASI_Mm01_00134692 predicted 1351
9 SASI_Mm02_00320964 predicted 350
10 SASI_Mm02_00320965 predicted 795
11 SASI_Mm01_00134689 predicted 841
12 SASI_Mm01_00134693 predicted 712
13 SASI_Mm01_00134694 predicted 438
14 SASI_Mm01_00134695 predicted 827
15 SASI_Mm01_00134696 predicted 981
16 SASI_Mm01_00134697 predicted 685
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011574
VALIDATED
CIRH1A MISSION shRNA Bacterial Glycerol Stock
cirrhosis, autosomal recessive 1A (cirhin)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011574.1-1642s1c1
Sequence:CCGGGCACTGTCTGTGTCCTTTCTTCTCGAGAAGAAAGGACACAGACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011574.1-1520s1c1
Sequence:CCGGCCTTGCTCTTTATGGATCTTTCTCGAGAAAGATCCATAAAGAGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011574.1-1318s1c1
Sequence:CCGGCCCATCACACACATCAGCTTTCTCGAGAAAGCTGATGTGTGTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011574.1-823s1c1
Sequence:CCGGCGATTGAAATATGAACGCGATCTCGAGATCGCGTTCATATTTCAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011574.1-838s1c1
Sequence:CCGGCGCGATAACATAAGCCTCCAACTCGAGTTGGAGGCTTATGTTATCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011574.2-592s21c1
Sequence:CCGGGTCAAATCAGGGAGCATAATTCTCGAGAATTATGCTCCCTGATTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011574.2-569s21c1
Sequence:CCGGTAGACTACATTAGCGTGTTTGCTCGAGCAAACACGCTAATGTAGTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011574.2-2143s21c1
Sequence:CCGGGCACTGTCTGTGTCCTTTCTTCTCGAGAAGAAAGGACACAGACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011574.2-1819s21c1
Sequence:CCGGCCCATCACACACATCAGCTTTCTCGAGAAAGCTGATGTGTGTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011574.2-1339s21c1
Sequence:CCGGCGCGATAACATAAGCCTCCAACTCGAGTTGGAGGCTTATGTTATCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011574
VALIDATED
CIRH1A MISSION shRNA shRNA Plasmid DNA
cirrhosis, autosomal recessive 1A (cirhin)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011574.1-1642s1c1
Sequence:CCGGGCACTGTCTGTGTCCTTTCTTCTCGAGAAGAAAGGACACAGACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011574.1-1520s1c1
Sequence:CCGGCCTTGCTCTTTATGGATCTTTCTCGAGAAAGATCCATAAAGAGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011574.1-1318s1c1
Sequence:CCGGCCCATCACACACATCAGCTTTCTCGAGAAAGCTGATGTGTGTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011574.1-823s1c1
Sequence:CCGGCGATTGAAATATGAACGCGATCTCGAGATCGCGTTCATATTTCAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011574.1-838s1c1
Sequence:CCGGCGCGATAACATAAGCCTCCAACTCGAGTTGGAGGCTTATGTTATCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011574.2-592s21c1
Sequence:CCGGGTCAAATCAGGGAGCATAATTCTCGAGAATTATGCTCCCTGATTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011574.2-569s21c1
Sequence:CCGGTAGACTACATTAGCGTGTTTGCTCGAGCAAACACGCTAATGTAGTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011574.2-2143s21c1
Sequence:CCGGGCACTGTCTGTGTCCTTTCTTCTCGAGAAGAAAGGACACAGACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011574.2-1819s21c1
Sequence:CCGGCCCATCACACACATCAGCTTTCTCGAGAAAGCTGATGTGTGTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011574.2-1339s21c1
Sequence:CCGGCGCGATAACATAAGCCTCCAACTCGAGTTGGAGGCTTATGTTATCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011574
VALIDATED
CIRH1A MISSION shRNA Lentiviral Transduction Particles
cirrhosis, autosomal recessive 1A (cirhin)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011574.1-1642s1c1
Sequence:CCGGGCACTGTCTGTGTCCTTTCTTCTCGAGAAGAAAGGACACAGACAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011574.1-1520s1c1
Sequence:CCGGCCTTGCTCTTTATGGATCTTTCTCGAGAAAGATCCATAAAGAGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011574.1-1318s1c1
Sequence:CCGGCCCATCACACACATCAGCTTTCTCGAGAAAGCTGATGTGTGTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011574.1-823s1c1
Sequence:CCGGCGATTGAAATATGAACGCGATCTCGAGATCGCGTTCATATTTCAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011574.1-838s1c1
Sequence:CCGGCGCGATAACATAAGCCTCCAACTCGAGTTGGAGGCTTATGTTATCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011574.2-592s21c1
Sequence:CCGGGTCAAATCAGGGAGCATAATTCTCGAGAATTATGCTCCCTGATTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011574.2-569s21c1
Sequence:CCGGTAGACTACATTAGCGTGTTTGCTCGAGCAAACACGCTAATGTAGTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011574.2-2143s21c1
Sequence:CCGGGCACTGTCTGTGTCCTTTCTTCTCGAGAAGAAAGGACACAGACAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011574.2-1819s21c1
Sequence:CCGGCCCATCACACACATCAGCTTTCTCGAGAAAGCTGATGTGTGTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011574.2-1339s21c1
Sequence:CCGGCGCGATAACATAAGCCTCCAACTCGAGTTGGAGGCTTATGTTATCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032830
VALIDATED
CIRH1A MISSION shRNA Bacterial Glycerol Stock
cirrhosis, autosomal recessive 1A (cirhin)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032830.1-187s1c1
Sequence:CCGGGCAAACTACTTTCAGGAGAAACTCGAGTTTCTCCTGAAAGTAGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032830.1-290s1c1
Sequence:CCGGGCGAGATTATGGAGTATGATTCTCGAGAATCATACTCCATAATCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032830.1-532s1c1
Sequence:CCGGGCTGGTTCCATAGACTACATTCTCGAGAATGTAGTCTATGGAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032830.1-729s1c1
Sequence:CCGGGCTTGTGAAGAGCCATCTCATCTCGAGATGAGATGGCTCTTCACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032830.2-707s21c1
Sequence:CCGGTGTCCGATGGCACTATCATAACTCGAGTTATGATAGTGCCATCGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032830.2-1948s21c1
Sequence:CCGGACCTTACTCTACAATCCATTTCTCGAGAAATGGATTGTAGAGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032830.2-643s21c1
Sequence:CCGGATTGTGGACAGGCAGTATATGCTCGAGCATATACTGCCTGTCCACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032830.2-327s21c1
Sequence:CCGGTGGGCTCAATGGCGAGATTATCTCGAGATAATCTCGCCATTGAGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032830.2-1730s21c1
Sequence:CCGGATTCGGACCAGCAGGTATTTGCTCGAGCAAATACCTGCTGGTCCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032830
VALIDATED
CIRH1A MISSION shRNA shRNA Plasmid DNA
cirrhosis, autosomal recessive 1A (cirhin)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032830.1-187s1c1
Sequence:CCGGGCAAACTACTTTCAGGAGAAACTCGAGTTTCTCCTGAAAGTAGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032830.1-290s1c1
Sequence:CCGGGCGAGATTATGGAGTATGATTCTCGAGAATCATACTCCATAATCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032830.1-532s1c1
Sequence:CCGGGCTGGTTCCATAGACTACATTCTCGAGAATGTAGTCTATGGAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032830.1-729s1c1
Sequence:CCGGGCTTGTGAAGAGCCATCTCATCTCGAGATGAGATGGCTCTTCACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032830.2-707s21c1
Sequence:CCGGTGTCCGATGGCACTATCATAACTCGAGTTATGATAGTGCCATCGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032830.2-1948s21c1
Sequence:CCGGACCTTACTCTACAATCCATTTCTCGAGAAATGGATTGTAGAGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032830.2-643s21c1
Sequence:CCGGATTGTGGACAGGCAGTATATGCTCGAGCATATACTGCCTGTCCACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032830.2-327s21c1
Sequence:CCGGTGGGCTCAATGGCGAGATTATCTCGAGATAATCTCGCCATTGAGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032830.2-1730s21c1
Sequence:CCGGATTCGGACCAGCAGGTATTTGCTCGAGCAAATACCTGCTGGTCCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032830
VALIDATED
CIRH1A MISSION shRNA Lentiviral Transduction Particles
cirrhosis, autosomal recessive 1A (cirhin)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032830.1-187s1c1
Sequence:CCGGGCAAACTACTTTCAGGAGAAACTCGAGTTTCTCCTGAAAGTAGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032830.1-290s1c1
Sequence:CCGGGCGAGATTATGGAGTATGATTCTCGAGAATCATACTCCATAATCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032830.1-532s1c1
Sequence:CCGGGCTGGTTCCATAGACTACATTCTCGAGAATGTAGTCTATGGAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032830.1-729s1c1
Sequence:CCGGGCTTGTGAAGAGCCATCTCATCTCGAGATGAGATGGCTCTTCACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032830.2-707s21c1
Sequence:CCGGTGTCCGATGGCACTATCATAACTCGAGTTATGATAGTGCCATCGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032830.2-1948s21c1
Sequence:CCGGACCTTACTCTACAATCCATTTCTCGAGAAATGGATTGTAGAGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032830.2-643s21c1
Sequence:CCGGATTGTGGACAGGCAGTATATGCTCGAGCATATACTGCCTGTCCACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032830.2-327s21c1
Sequence:CCGGTGGGCTCAATGGCGAGATTATCTCGAGATAATCTCGCCATTGAGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032830.2-1730s21c1
Sequence:CCGGATTCGGACCAGCAGGTATTTGCTCGAGCAAATACCTGCTGGTCCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)