EMAIL THIS PAGE TO A FRIEND

CISD3

CDGSH iron sulfur domain 3

93 Gene Product Result for
Synonyms: Miner2
UniProtKB ID: P0C7P0
Gene ID:
Human(284106) Summary: CISD3 is a member of the CDGSH domain-containing family, which may play a role in regulating electron transport and oxidative phosphorylation (Wiley et al., 2007 [PubMed 17376863]
Mouse(217149) CDGSH iron sulfur domain 3
Rat(287661) CDGSH iron sulfur domain 3
domestic guinea pig(100719211) CDGSH iron sulfur domain 3
naked mole-rat(101722492) CDGSH iron sulfur domain 3
sheep(101120095) CDGSH iron sulfur domain 3
dog(491036) CDGSH iron sulfur domain 3
domestic cat(101099848) CDGSH iron sulfur domain 3
cow(618350) CDGSH iron sulfur domain 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001085500 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085500 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085500 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001136498 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136498 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136498 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU221171 MISSION® esiRNA esiRNA targeting human CISD3 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714917 Rosetta Predictions human pricing
XM_001716624 Rosetta Predictions human pricing
XM_001718346 Rosetta Predictions human pricing
NM_001105835 Rosetta Predictions rat pricing
NM_001085500 Rosetta Predictions mouse pricing
XM_126589 Rosetta Predictions mouse pricing
XM_895143 Rosetta Predictions mouse pricing
XM_994296 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00400250 predicted 272
2 SASI_Hs02_00400251 predicted 708
3 SASI_Hs02_00400252 predicted 698
4 SASI_Hs02_00400253 predicted 597
5 SASI_Hs02_00400254 predicted 817
6 SASI_Hs02_00400255 predicted 493
7 SASI_Hs02_00400256 predicted 555
8 SASI_Hs02_00400257 predicted 450
9 SASI_Hs02_00400258 predicted 232
10 SASI_Hs02_00400259 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00411780 predicted 423
2 SASI_Hs02_00411781 predicted 866
3 SASI_Hs02_00411782 predicted 851
4 SASI_Hs02_00411783 predicted 756
5 SASI_Hs02_00411784 predicted 963
6 SASI_Hs02_00411785 predicted 648
7 SASI_Hs02_00411786 predicted 704
8 SASI_Hs02_00411787 predicted 600
9 SASI_Hs02_00411788 predicted 384
10 SASI_Hs02_00411789 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00423222 predicted 399
2 SASI_Hs02_00423223 predicted 837
3 SASI_Hs02_00423224 predicted 826
4 SASI_Hs02_00423225 predicted 729
5 SASI_Hs02_00423226 predicted 937
6 SASI_Hs02_00423227 predicted 619
7 SASI_Hs02_00423228 predicted 685
8 SASI_Hs02_00423229 predicted 579
9 SASI_Hs02_00423230 predicted 354
10 SASI_Hs02_00423231 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105835 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212996 predicted 575
2 SASI_Rn02_00212997 predicted 472
3 SASI_Rn02_00212998 predicted 393
4 SASI_Rn02_00212999 predicted 391
5 SASI_Rn02_00213000 predicted 508
6 SASI_Rn02_00213001 predicted 669
7 SASI_Rn02_00213002 predicted 496
8 SASI_Rn02_00213003 predicted 475
9 SASI_Rn02_00213004 predicted 391
10 SASI_Rn02_00213005 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300582 predicted 351
2 SASI_Mm02_00300583 predicted 425
3 SASI_Mm02_00300584 predicted 459
4 SASI_Mm02_00300585 predicted 446
5 SASI_Mm02_00300586 predicted 438
6 SASI_Mm02_00300587 predicted 416
7 SASI_Mm02_00300588 predicted 455
8 SASI_Mm02_00300589 predicted 498
9 SASI_Mm02_00300590 predicted 389
10 SASI_Mm02_00300591 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_126589 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273290 predicted 459
2 SASI_Mm01_00273291 predicted 538
3 SASI_Mm01_00273292 predicted 572
4 SASI_Mm01_00273293 predicted 333
5 SASI_Mm01_00273294 predicted 334
6 SASI_Mm01_00273295 predicted 355
7 SASI_Mm01_00273296 predicted 520
8 SASI_Mm01_00273297 predicted 600
9 SASI_Mm01_00273298 predicted 498
10 SASI_Mm01_00273299 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895143 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262601 predicted 235
2 SASI_Mm01_00262602 predicted 279
3 SASI_Mm01_00262603 predicted 262
4 SASI_Mm01_00262604 predicted 231
5 SASI_Mm01_00262605 predicted 256
6 SASI_Mm01_00262606 predicted 225
7 SASI_Mm01_00262607 predicted 270
8 SASI_Mm01_00262608 predicted 227
9 SASI_Mm01_00262609 predicted 313
10 SASI_Mm01_00262610 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994296 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273567 predicted 719
2 SASI_Mm01_00273568 predicted 795
3 SASI_Mm01_00273569 predicted 830
4 SASI_Mm01_00273570 predicted 825
5 SASI_Mm01_00273571 predicted 814
6 SASI_Mm01_00273572 predicted 779
7 SASI_Mm01_00273573 predicted 825
8 SASI_Mm01_00273574 predicted 860
9 SASI_Mm01_00273575 predicted 755
10 SASI_Mm01_00273576 predicted 734
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085500
VALIDATED
CISD3 MISSION shRNA Bacterial Glycerol Stock
CDGSH iron sulfur domain 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085500.2-572s21c1
Sequence:CCGGCTGTGACTCCAGGCAGTAATGCTCGAGCATTACTGCCTGGAGTCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085500.2-190s21c1
Sequence:CCGGTTTCTGTTTCCAAATCATATCCTCGAGGATATGATTTGGAAACAGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085500.2-420s21c1
Sequence:CCGGTGGCCTTTCTCCACTCAAGTTCTCGAGAACTTGAGTGGAGAAAGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085500.2-233s21c1
Sequence:CCGGCGTATCAGAGGCGGGAAATCTCTCGAGAGATTTCCCGCCTCTGATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085500.2-362s21c1
Sequence:CCGGTATGTGGCCGAAGCAAGAATCCTCGAGGATTCTTGCTTCGGCCACATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085500.2-219s21c1
Sequence:CCGGTGCCTTGTCGAAGCCGTATCACTCGAGTGATACGGCTTCGACAAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085500.2-307s21c1
Sequence:CCGGCAGAAGACACCCATCAGATTGCTCGAGCAATCTGATGGGTGTCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085500.2-400s21c1
Sequence:CCGGTCCCACTTCTTCCAGCGTACTCTCGAGAGTACGCTGGAAGAAGTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085500
VALIDATED
CISD3 MISSION shRNA shRNA Plasmid DNA
CDGSH iron sulfur domain 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085500.2-572s21c1
Sequence:CCGGCTGTGACTCCAGGCAGTAATGCTCGAGCATTACTGCCTGGAGTCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085500.2-190s21c1
Sequence:CCGGTTTCTGTTTCCAAATCATATCCTCGAGGATATGATTTGGAAACAGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085500.2-420s21c1
Sequence:CCGGTGGCCTTTCTCCACTCAAGTTCTCGAGAACTTGAGTGGAGAAAGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085500.2-233s21c1
Sequence:CCGGCGTATCAGAGGCGGGAAATCTCTCGAGAGATTTCCCGCCTCTGATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085500.2-362s21c1
Sequence:CCGGTATGTGGCCGAAGCAAGAATCCTCGAGGATTCTTGCTTCGGCCACATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085500.2-219s21c1
Sequence:CCGGTGCCTTGTCGAAGCCGTATCACTCGAGTGATACGGCTTCGACAAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085500.2-307s21c1
Sequence:CCGGCAGAAGACACCCATCAGATTGCTCGAGCAATCTGATGGGTGTCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085500.2-400s21c1
Sequence:CCGGTCCCACTTCTTCCAGCGTACTCTCGAGAGTACGCTGGAAGAAGTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085500
VALIDATED
CISD3 MISSION shRNA Lentiviral Transduction Particles
CDGSH iron sulfur domain 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085500.2-572s21c1
Sequence:CCGGCTGTGACTCCAGGCAGTAATGCTCGAGCATTACTGCCTGGAGTCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085500.2-190s21c1
Sequence:CCGGTTTCTGTTTCCAAATCATATCCTCGAGGATATGATTTGGAAACAGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085500.2-420s21c1
Sequence:CCGGTGGCCTTTCTCCACTCAAGTTCTCGAGAACTTGAGTGGAGAAAGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085500.2-233s21c1
Sequence:CCGGCGTATCAGAGGCGGGAAATCTCTCGAGAGATTTCCCGCCTCTGATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085500.2-362s21c1
Sequence:CCGGTATGTGGCCGAAGCAAGAATCCTCGAGGATTCTTGCTTCGGCCACATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085500.2-219s21c1
Sequence:CCGGTGCCTTGTCGAAGCCGTATCACTCGAGTGATACGGCTTCGACAAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085500.2-307s21c1
Sequence:CCGGCAGAAGACACCCATCAGATTGCTCGAGCAATCTGATGGGTGTCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085500.2-400s21c1
Sequence:CCGGTCCCACTTCTTCCAGCGTACTCTCGAGAGTACGCTGGAAGAAGTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136498
VALIDATED
CISD3 MISSION shRNA Bacterial Glycerol Stock
CDGSH iron sulfur domain 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136498.1-602s21c1
Sequence:CCGGGCTCATGAAGGAAGAATTATTCTCGAGAATAATTCTTCCTTCATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136498.1-185s21c1
Sequence:CCGGTGGCCCAGTGGTTCCCTAGAACTCGAGTTCTAGGGAACCACTGGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136498.1-394s21c1
Sequence:CCGGTGTACCTGCAAGGCCACTCAGCTCGAGCTGAGTGGCCTTGCAGGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136498.1-313s21c1
Sequence:CCGGTGTGACGGCTCCCACTTCTTCCTCGAGGAAGAAGTGGGAGCCGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136498.1-343s21c1
Sequence:CCGGGGCCTATCTCCACTCAAGTTCCTCGAGGAACTTGAGTGGAGATAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136498
VALIDATED
CISD3 MISSION shRNA shRNA Plasmid DNA
CDGSH iron sulfur domain 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136498.1-602s21c1
Sequence:CCGGGCTCATGAAGGAAGAATTATTCTCGAGAATAATTCTTCCTTCATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136498.1-185s21c1
Sequence:CCGGTGGCCCAGTGGTTCCCTAGAACTCGAGTTCTAGGGAACCACTGGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136498.1-394s21c1
Sequence:CCGGTGTACCTGCAAGGCCACTCAGCTCGAGCTGAGTGGCCTTGCAGGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136498.1-313s21c1
Sequence:CCGGTGTGACGGCTCCCACTTCTTCCTCGAGGAAGAAGTGGGAGCCGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136498.1-343s21c1
Sequence:CCGGGGCCTATCTCCACTCAAGTTCCTCGAGGAACTTGAGTGGAGATAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136498
VALIDATED
CISD3 MISSION shRNA Lentiviral Transduction Particles
CDGSH iron sulfur domain 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136498.1-602s21c1
Sequence:CCGGGCTCATGAAGGAAGAATTATTCTCGAGAATAATTCTTCCTTCATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136498.1-185s21c1
Sequence:CCGGTGGCCCAGTGGTTCCCTAGAACTCGAGTTCTAGGGAACCACTGGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136498.1-394s21c1
Sequence:CCGGTGTACCTGCAAGGCCACTCAGCTCGAGCTGAGTGGCCTTGCAGGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136498.1-313s21c1
Sequence:CCGGTGTGACGGCTCCCACTTCTTCCTCGAGGAAGAAGTGGGAGCCGTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001136498.1-343s21c1
Sequence:CCGGGGCCTATCTCCACTCAAGTTCCTCGAGGAACTTGAGTGGAGATAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)