EMAIL THIS PAGE TO A FRIEND

CKMT1A

creatine kinase, mitochondrial 1A

24 Gene Product Result for
Synonyms: CKMT1
Species: Human CKMT1A(548596), Domestic Rabbit CKMT1A(100328683), domestic guinea pig Ckmt1a(100725326), chicken CKMT1A(374002)
UniProtKB ID: P12532, B4DIT8, B7ZA09, Q0VAM3, Q32NF6, Q53FC4
Gene ID:
Human(548596) Summary: Mitochondrial creatine (MtCK) kinase is responsible for the transfer of high energy phosphate from mitochondria to the cytosolic carrier, creatine. It belongs to the creatine kinase isoenzyme family. It exists as two isoenzymes, sarcomeric MtCK and ubiquitous MtCK, encoded by separate genes. Mitochondrial creatine kinase occurs in two different oligomeric forms: dimers and octamers, in contrast to the exclusively dimeric cytosolic creatine kinase isoenzymes. Many malignant cancers with poor prognosis have shown overexpression of ubiquitous mitochondrial creatine kinase; this may be related to high energy turnover and failure to eliminate cancer cells via apoptosis. Ubiquitous mitochondrial creatine kinase has 80% homology with the coding exons of sarcomeric mitochondrial creatine kinase. Two genes located near each other on chromosome 15 have been identified which encode identical mitochondrial creatine kinase proteins. [provided by RefSeq, Jul 2008]
Domestic Rabbit(100328683) creatine kinase, mitochondrial 1A
domestic guinea pig(100725326) creatine kinase, mitochondrial 1A
chicken(374002) creatine kinase, mitochondrial 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001015001 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001015001 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001015001 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001015001 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065520 predicted 810
2 SASI_Hs02_00306633 predicted 805
3 SASI_Hs01_00065521 predicted 937
4 SASI_Hs01_00065522 predicted 982
5 SASI_Hs01_00065525 predicted 1039
6 SASI_Hs01_00065526 predicted 1173
7 SASI_Hs02_00306634 predicted 629
8 SASI_Hs01_00065528 predicted 766
9 SASI_Hs01_00065529 predicted 904
10 SASI_Hs02_00306635 predicted 635
11 SASI_Hs01_00065523 predicted 1137
12 SASI_Hs01_00065524 predicted 737
13 SASI_Hs01_00065527 predicted 836
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001015001
VALIDATED
CKMT1A MISSION shRNA Bacterial Glycerol Stock
creatine kinase, mitochondrial 1A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001015001.1-1175s21c1
Sequence:CCGGGGTGAATGAGGAGGATCATACCTCGAGGTATGATCCTCCTCATTCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001015001.1-994s1c1
Sequence:CCGGACCTGGCTGGACGTTACTATACTCGAGTATAGTAACGTCCAGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001015001.1-1123s1c1
Sequence:CCGGGGCCAGATGCTCGTGGAATTTCTCGAGAAATTCCACGAGCATCTGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001015001.1-1550s21c1
Sequence:CCGGCATCGATGGAGTAAACTATTTCTCGAGAAATAGTTTACTCCATCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001015001.1-816s21c1
Sequence:CCGGACGGATCTAGATGCCAGTAAACTCGAGTTTACTGGCATCTAGATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001015001.1-1481s21c1
Sequence:CCGGAGGCGGTGTCTTTGATATTTCCTCGAGGAAATATCAAAGACACCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001015001.1-725s21c1
Sequence:CCGGTGAGGAGACCTATGAGGTATTCTCGAGAATACCTCATAGGTCTCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001015001.1-560s1c1
Sequence:CCGGCCGAAAGCACAACAACTGCATCTCGAGATGCAGTTGTTGTGCTTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001015001.1-1046s1c1
Sequence:CCGGGCAGCTTATTGATGACCACTTCTCGAGAAGTGGTCATCAATAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001015001.1-1035s1c1
Sequence:CCGGGCTGAACAGCAGCAGCTTATTCTCGAGAATAAGCTGCTGCTGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001015001
VALIDATED
CKMT1A MISSION shRNA shRNA Plasmid DNA
creatine kinase, mitochondrial 1A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001015001.1-1175s21c1
Sequence:CCGGGGTGAATGAGGAGGATCATACCTCGAGGTATGATCCTCCTCATTCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001015001.1-994s1c1
Sequence:CCGGACCTGGCTGGACGTTACTATACTCGAGTATAGTAACGTCCAGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001015001.1-1123s1c1
Sequence:CCGGGGCCAGATGCTCGTGGAATTTCTCGAGAAATTCCACGAGCATCTGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001015001.1-1550s21c1
Sequence:CCGGCATCGATGGAGTAAACTATTTCTCGAGAAATAGTTTACTCCATCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001015001.1-816s21c1
Sequence:CCGGACGGATCTAGATGCCAGTAAACTCGAGTTTACTGGCATCTAGATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001015001.1-1481s21c1
Sequence:CCGGAGGCGGTGTCTTTGATATTTCCTCGAGGAAATATCAAAGACACCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001015001.1-725s21c1
Sequence:CCGGTGAGGAGACCTATGAGGTATTCTCGAGAATACCTCATAGGTCTCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001015001.1-560s1c1
Sequence:CCGGCCGAAAGCACAACAACTGCATCTCGAGATGCAGTTGTTGTGCTTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001015001.1-1046s1c1
Sequence:CCGGGCAGCTTATTGATGACCACTTCTCGAGAAGTGGTCATCAATAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001015001.1-1035s1c1
Sequence:CCGGGCTGAACAGCAGCAGCTTATTCTCGAGAATAAGCTGCTGCTGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001015001
VALIDATED
CKMT1A MISSION shRNA Lentiviral Transduction Particles
creatine kinase, mitochondrial 1A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001015001.1-1175s21c1
Sequence:CCGGGGTGAATGAGGAGGATCATACCTCGAGGTATGATCCTCCTCATTCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001015001.1-994s1c1
Sequence:CCGGACCTGGCTGGACGTTACTATACTCGAGTATAGTAACGTCCAGCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001015001.1-1123s1c1
Sequence:CCGGGGCCAGATGCTCGTGGAATTTCTCGAGAAATTCCACGAGCATCTGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001015001.1-1550s21c1
Sequence:CCGGCATCGATGGAGTAAACTATTTCTCGAGAAATAGTTTACTCCATCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001015001.1-816s21c1
Sequence:CCGGACGGATCTAGATGCCAGTAAACTCGAGTTTACTGGCATCTAGATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001015001.1-1481s21c1
Sequence:CCGGAGGCGGTGTCTTTGATATTTCCTCGAGGAAATATCAAAGACACCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001015001.1-725s21c1
Sequence:CCGGTGAGGAGACCTATGAGGTATTCTCGAGAATACCTCATAGGTCTCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001015001.1-560s1c1
Sequence:CCGGCCGAAAGCACAACAACTGCATCTCGAGATGCAGTTGTTGTGCTTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001015001.1-1046s1c1
Sequence:CCGGGCAGCTTATTGATGACCACTTCTCGAGAAGTGGTCATCAATAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001015001.1-1035s1c1
Sequence:CCGGGCTGAACAGCAGCAGCTTATTCTCGAGAATAAGCTGCTGCTGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)