EMAIL THIS PAGE TO A FRIEND

CLASRP

CLK4-associating serine/arginine rich protein

88 Gene Product Result for
Synonyms: CLASP SFRS16 SWAP2
UniProtKB ID: Q8N2M8, O96026, Q6UW71, Q96DX2
Gene ID:
Mouse(53609) CLK4-associating serine/arginine rich protein
Rat(499390) CLK4-associating serine/arginine rich protein
Zebrafish(555304) CLK4-associating serine/arginine rich protein
dog(476436) CLK4-associating serine/arginine rich protein
domestic cat(101085510) CLK4-associating serine/arginine rich protein
cow(509208) CLK4-associating serine/arginine rich protein
sheep(101113265) CLK4-associating serine/arginine rich protein
naked mole-rat(101719624) CLK4-associating serine/arginine rich protein
domestic guinea pig(100732180) CLK4-associating serine/arginine rich protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007056 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007056 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007056 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_152946 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152946 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152946 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016680 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016680 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016680 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007056 Rosetta Predictions human pricing
NM_001024294 Rosetta Predictions rat pricing
NM_016680 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177299 predicted 275
2 SASI_Hs01_00177300 predicted 887
3 SASI_Hs01_00177301 predicted 956
4 SASI_Hs01_00177302 predicted 768
5 SASI_Hs01_00177303 predicted 489
6 SASI_Hs01_00177304 predicted 436
7 SASI_Hs01_00177305 predicted 460
8 SASI_Hs01_00177306 predicted 271
9 SASI_Hs01_00177307 predicted 671
10 SASI_Hs02_00342863 predicted 330
11 SASI_Hs01_00177308 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024294 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202484 predicted 623
2 SASI_Rn01_00117175 predicted 535
3 SASI_Rn01_00117176 predicted 549
4 SASI_Rn01_00117177 predicted 231
5 SASI_Rn01_00117178 predicted 203
6 SASI_Rn01_00117179 predicted 446
7 SASI_Rn01_00117180 predicted 847
8 SASI_Rn01_00117181 predicted 311
9 SASI_Rn01_00117182 predicted 364
10 SASI_Rn01_00117183 predicted 287
11 SASI_Rn01_00117184 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163545 predicted 310
2 SASI_Mm01_00163546 predicted 204
3 SASI_Mm01_00163547 predicted 464
4 SASI_Mm02_00323321 predicted 219
5 SASI_Mm01_00163548 predicted 560
6 SASI_Mm01_00163549 predicted 380
7 SASI_Mm01_00163550 predicted 769
8 SASI_Mm01_00163551 predicted 1571
9 SASI_Mm01_00163552 predicted 925
10 SASI_Mm01_00163553 predicted 228
11 SASI_Mm01_00163554 predicted 384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007056
VALIDATED
CLASRP MISSION shRNA Bacterial Glycerol Stock
CLK4-associating serine/arginine rich protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007056.1-500s1c1
Sequence:CCGGCCAGATCTACATTGATGAGTTCTCGAGAACTCATCAATGTAGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_007056.1-2047s1c1
Sequence:CCGGCCCGATACAGTCGAGAATACACTCGAGTGTATTCTCGACTGTATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007056.1-908s1c1
Sequence:CCGGGCGGAGAGAGTTTCGGGAGAACTCGAGTTCTCCCGAAACTCTCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007056.1-1061s1c1
Sequence:CCGGCCGCGAGGAGAAGATCACGTTCTCGAGAACGTGATCTTCTCCTCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_007056.1-317s1c1
Sequence:CCGGCAACAACATGATTGACCGATTCTCGAGAATCGGTCAATCATGTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007056.2-168s21c1
Sequence:CCGGGAGCGGAGACGGGAGTATTATCTCGAGATAATACTCCCGTCTCCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007056.2-574s21c1
Sequence:CCGGAGAAGGCTTCCATCGGTTATACTCGAGTATAACCGATGGAAGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007056.2-1061s21c1
Sequence:CCGGCCGCGAGGAGAAGATCACGTTCTCGAGAACGTGATCTTCTCCTCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007056.2-317s21c1
Sequence:CCGGCAACAACATGATTGACCGATTCTCGAGAATCGGTCAATCATGTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007056.2-908s21c1
Sequence:CCGGGCGGAGAGAGTTTCGGGAGAACTCGAGTTCTCCCGAAACTCTCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007056
VALIDATED
CLASRP MISSION shRNA shRNA Plasmid DNA
CLK4-associating serine/arginine rich protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007056.1-500s1c1
Sequence:CCGGCCAGATCTACATTGATGAGTTCTCGAGAACTCATCAATGTAGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_007056.1-2047s1c1
Sequence:CCGGCCCGATACAGTCGAGAATACACTCGAGTGTATTCTCGACTGTATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007056.1-908s1c1
Sequence:CCGGGCGGAGAGAGTTTCGGGAGAACTCGAGTTCTCCCGAAACTCTCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007056.1-1061s1c1
Sequence:CCGGCCGCGAGGAGAAGATCACGTTCTCGAGAACGTGATCTTCTCCTCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_007056.1-317s1c1
Sequence:CCGGCAACAACATGATTGACCGATTCTCGAGAATCGGTCAATCATGTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007056.2-168s21c1
Sequence:CCGGGAGCGGAGACGGGAGTATTATCTCGAGATAATACTCCCGTCTCCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007056.2-574s21c1
Sequence:CCGGAGAAGGCTTCCATCGGTTATACTCGAGTATAACCGATGGAAGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007056.2-1061s21c1
Sequence:CCGGCCGCGAGGAGAAGATCACGTTCTCGAGAACGTGATCTTCTCCTCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007056.2-317s21c1
Sequence:CCGGCAACAACATGATTGACCGATTCTCGAGAATCGGTCAATCATGTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007056.2-908s21c1
Sequence:CCGGGCGGAGAGAGTTTCGGGAGAACTCGAGTTCTCCCGAAACTCTCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007056
VALIDATED
CLASRP MISSION shRNA Lentiviral Transduction Particles
CLK4-associating serine/arginine rich protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007056.1-500s1c1
Sequence:CCGGCCAGATCTACATTGATGAGTTCTCGAGAACTCATCAATGTAGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_007056.1-2047s1c1
Sequence:CCGGCCCGATACAGTCGAGAATACACTCGAGTGTATTCTCGACTGTATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007056.1-908s1c1
Sequence:CCGGGCGGAGAGAGTTTCGGGAGAACTCGAGTTCTCCCGAAACTCTCTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007056.1-1061s1c1
Sequence:CCGGCCGCGAGGAGAAGATCACGTTCTCGAGAACGTGATCTTCTCCTCGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_007056.1-317s1c1
Sequence:CCGGCAACAACATGATTGACCGATTCTCGAGAATCGGTCAATCATGTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007056.2-168s21c1
Sequence:CCGGGAGCGGAGACGGGAGTATTATCTCGAGATAATACTCCCGTCTCCGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007056.2-574s21c1
Sequence:CCGGAGAAGGCTTCCATCGGTTATACTCGAGTATAACCGATGGAAGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007056.2-1061s21c1
Sequence:CCGGCCGCGAGGAGAAGATCACGTTCTCGAGAACGTGATCTTCTCCTCGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007056.2-317s21c1
Sequence:CCGGCAACAACATGATTGACCGATTCTCGAGAATCGGTCAATCATGTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007056.2-908s21c1
Sequence:CCGGGCGGAGAGAGTTTCGGGAGAACTCGAGTTCTCCCGAAACTCTCTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152946
VALIDATED
CLASRP MISSION shRNA Bacterial Glycerol Stock
CLK4-associating serine/arginine rich protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152946.1-1893s1c1
Sequence:CCGGGCTACAGTCGAGAGTACAGTTCTCGAGAACTGTACTCTCGACTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152946.1-694s1c1
Sequence:CCGGGAGGCCATCAAACATGCCAAACTCGAGTTTGGCATGTTTGATGGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152946.1-190s1c1
Sequence:CCGGCGCTTTGATGTTCGTGCACATCTCGAGATGTGCACGAACATCAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152946.1-446s1c1
Sequence:CCGGGCTACACCTATGAAGATAGTACTCGAGTACTATCTTCATAGGTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152946.1-34s1c1
Sequence:CCGGCGGGAGTACTATGAGAAGATTCTCGAGAATCTTCTCATAGTACTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152946
VALIDATED
CLASRP MISSION shRNA shRNA Plasmid DNA
CLK4-associating serine/arginine rich protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152946.1-1893s1c1
Sequence:CCGGGCTACAGTCGAGAGTACAGTTCTCGAGAACTGTACTCTCGACTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152946.1-694s1c1
Sequence:CCGGGAGGCCATCAAACATGCCAAACTCGAGTTTGGCATGTTTGATGGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152946.1-190s1c1
Sequence:CCGGCGCTTTGATGTTCGTGCACATCTCGAGATGTGCACGAACATCAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152946.1-446s1c1
Sequence:CCGGGCTACACCTATGAAGATAGTACTCGAGTACTATCTTCATAGGTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152946.1-34s1c1
Sequence:CCGGCGGGAGTACTATGAGAAGATTCTCGAGAATCTTCTCATAGTACTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152946
VALIDATED
CLASRP MISSION shRNA Lentiviral Transduction Particles
CLK4-associating serine/arginine rich protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152946.1-1893s1c1
Sequence:CCGGGCTACAGTCGAGAGTACAGTTCTCGAGAACTGTACTCTCGACTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152946.1-694s1c1
Sequence:CCGGGAGGCCATCAAACATGCCAAACTCGAGTTTGGCATGTTTGATGGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152946.1-190s1c1
Sequence:CCGGCGCTTTGATGTTCGTGCACATCTCGAGATGTGCACGAACATCAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152946.1-446s1c1
Sequence:CCGGGCTACACCTATGAAGATAGTACTCGAGTACTATCTTCATAGGTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152946.1-34s1c1
Sequence:CCGGCGGGAGTACTATGAGAAGATTCTCGAGAATCTTCTCATAGTACTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016680
VALIDATED
CLASRP MISSION shRNA Bacterial Glycerol Stock
CLK4-associating serine/arginine rich protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016680.4-385s21c1
Sequence:CCGGAGGAGTCAGACGAGCGGAAATCTCGAGATTTCCGCTCGTCTGACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016680.4-1961s21c1
Sequence:CCGGAGAATGGGAACGCCAATATAGCTCGAGCTATATTGGCGTTCCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016680.4-721s21c1
Sequence:CCGGAGCAGGTGGCTGATCTCAATACTCGAGTATTGAGATCAGCCACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016680.4-309s21c1
Sequence:CCGGCGCTTTGATGTTCGTGCACATCTCGAGATGTGCACGAACATCAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016680.4-1475s21c1
Sequence:CCGGCCGTTCAGGTGACCGCTATAACTCGAGTTATAGCGGTCACCTGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016680
VALIDATED
CLASRP MISSION shRNA shRNA Plasmid DNA
CLK4-associating serine/arginine rich protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016680.4-385s21c1
Sequence:CCGGAGGAGTCAGACGAGCGGAAATCTCGAGATTTCCGCTCGTCTGACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016680.4-1961s21c1
Sequence:CCGGAGAATGGGAACGCCAATATAGCTCGAGCTATATTGGCGTTCCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016680.4-721s21c1
Sequence:CCGGAGCAGGTGGCTGATCTCAATACTCGAGTATTGAGATCAGCCACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016680.4-309s21c1
Sequence:CCGGCGCTTTGATGTTCGTGCACATCTCGAGATGTGCACGAACATCAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016680.4-1475s21c1
Sequence:CCGGCCGTTCAGGTGACCGCTATAACTCGAGTTATAGCGGTCACCTGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016680
VALIDATED
CLASRP MISSION shRNA Lentiviral Transduction Particles
CLK4-associating serine/arginine rich protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016680.4-385s21c1
Sequence:CCGGAGGAGTCAGACGAGCGGAAATCTCGAGATTTCCGCTCGTCTGACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016680.4-1961s21c1
Sequence:CCGGAGAATGGGAACGCCAATATAGCTCGAGCTATATTGGCGTTCCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016680.4-721s21c1
Sequence:CCGGAGCAGGTGGCTGATCTCAATACTCGAGTATTGAGATCAGCCACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016680.4-309s21c1
Sequence:CCGGCGCTTTGATGTTCGTGCACATCTCGAGATGTGCACGAACATCAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016680.4-1475s21c1
Sequence:CCGGCCGTTCAGGTGACCGCTATAACTCGAGTTATAGCGGTCACCTGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)