EMAIL THIS PAGE TO A FRIEND

CLDN23

claudin 23

70 Gene Product Result for
Synonyms: CLDNL hCG1646163
UniProtKB ID: Q96B33, Q08AJ3
Gene ID:
Human(137075) Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is expressed in germinal center B-cells, placenta and stomach as well as in colon tumor. This gene is down-regulated in intestinal type gastric cancer. [provided by RefSeq, Aug 2010]
Mouse(71908) claudin 23
Rat(290789) claudin 23
chicken(428756) claudin 23
cow(514634) claudin 23
dog(100687225) claudin 23
sheep(101113389) claudin 23
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194284 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027998 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027998 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027998 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194284 Rosetta Predictions human pricing
NM_001033062 Rosetta Predictions rat pricing
NM_027998 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225324 predicted 1212
2 SASI_Hs02_00371410 predicted 357
3 SASI_Hs02_00371411 predicted 335
4 SASI_Hs02_00371412 predicted 621
5 SASI_Hs01_00225326 predicted 1234
6 SASI_Hs01_00225327 predicted 1247
7 SASI_Hs01_00225328 predicted 761
8 SASI_Hs01_00225329 predicted 1234
9 SASI_Hs01_00225330 predicted 1208
10 SASI_Hs01_00225331 predicted 1180
11 SASI_Hs01_00225325 predicted 887
12 SASI_Hs01_00225332 predicted 258
13 SASI_Hs01_00225333 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033062 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076732 predicted 1467
2 SASI_Rn01_00076733 predicted 1268
3 SASI_Rn01_00076734 predicted 1224
4 SASI_Rn01_00076735 predicted 1042
5 SASI_Rn01_00076736 predicted 875
6 SASI_Rn01_00076737 predicted 1245
7 SASI_Rn01_00076738 predicted 1127
8 SASI_Rn01_00076739 predicted 1298
9 SASI_Rn02_00203621 predicted 981
10 SASI_Rn01_00076741 predicted 1199
11 SASI_Rn01_00076740 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027998 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333085 predicted 1238
2 SASI_Mm01_00142216 predicted 1353
3 SASI_Mm02_00333086 predicted 1590
4 SASI_Mm01_00142218 predicted 1002
5 SASI_Mm01_00142219 predicted 1324
6 SASI_Mm01_00142224 predicted 1447
7 SASI_Mm01_00142222 predicted 277
8 SASI_Mm01_00142223 predicted 282
9 SASI_Mm01_00142217 predicted 1104
10 SASI_Mm02_00333087 predicted 1153
11 SASI_Mm01_00142215 predicted 1490
12 SASI_Mm01_00142220 predicted 1520
13 SASI_Mm01_00142221 predicted 1231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194284
CLDN23 MISSION shRNA Bacterial Glycerol Stock
claudin 23
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194284.2-1111s21c1
Sequence:CCGGTCCGACCTCTAGACGCTTGTACTCGAGTACAAGCGTCTAGAGGTCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194284.2-1455s21c1
Sequence:CCGCTAACATGTTGAAACGACAATACTCGAGTATTGTCGTTTCAACATGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163161    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194284.1-1180s1c1
Sequence:CCGGGCAAACTCTCAAGAGGCCAATCTCGAGATTGGCCTCTTGAGAGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161659    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194284.1-1403s1c1
Sequence:CCGGGAGGAGAACAAAGGTCCTAATCTCGAGATTAGGACCTTTGTTCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161155    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194284.1-1211s1c1
Sequence:CCGGCCATGTTTGAATGAGCCTCTTCTCGAGAAGAGGCTCATTCAAACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194284.1-894s1c1
Sequence:CCGGCGATTAGTTCAGGTTGGGTTTCTCGAGAAACCCAACCTGAACTAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194284.1-1212s1c1
Sequence:CCGGCATGTTTGAATGAGCCTCTTACTCGAGTAAGAGGCTCATTCAAACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194284.1-1259s1c1
Sequence:CCGGCAGCAGCTTAATGGATTTCATCTCGAGATGAAATCCATTAAGCTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194284.1-1061s1c1
Sequence:CCGGGCAGTGCTCAGAAACAATTTACTCGAGTAAATTGTTTCTGAGCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194284.1-1181s1c1
Sequence:CCGGCAAACTCTCAAGAGGCCAATACTCGAGTATTGGCCTCTTGAGAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194284
CLDN23 MISSION shRNA shRNA Plasmid DNA
claudin 23
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194284.2-1111s21c1
Sequence:CCGGTCCGACCTCTAGACGCTTGTACTCGAGTACAAGCGTCTAGAGGTCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194284.2-1455s21c1
Sequence:CCGCTAACATGTTGAAACGACAATACTCGAGTATTGTCGTTTCAACATGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163161    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194284.1-1180s1c1
Sequence:CCGGGCAAACTCTCAAGAGGCCAATCTCGAGATTGGCCTCTTGAGAGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161659    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194284.1-1403s1c1
Sequence:CCGGGAGGAGAACAAAGGTCCTAATCTCGAGATTAGGACCTTTGTTCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161155    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194284.1-1211s1c1
Sequence:CCGGCCATGTTTGAATGAGCCTCTTCTCGAGAAGAGGCTCATTCAAACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194284.1-894s1c1
Sequence:CCGGCGATTAGTTCAGGTTGGGTTTCTCGAGAAACCCAACCTGAACTAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194284.1-1212s1c1
Sequence:CCGGCATGTTTGAATGAGCCTCTTACTCGAGTAAGAGGCTCATTCAAACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194284.1-1259s1c1
Sequence:CCGGCAGCAGCTTAATGGATTTCATCTCGAGATGAAATCCATTAAGCTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194284.1-1061s1c1
Sequence:CCGGGCAGTGCTCAGAAACAATTTACTCGAGTAAATTGTTTCTGAGCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194284.1-1181s1c1
Sequence:CCGGCAAACTCTCAAGAGGCCAATACTCGAGTATTGGCCTCTTGAGAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194284
CLDN23 MISSION shRNA Lentiviral Transduction Particles
claudin 23
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194284.2-1111s21c1
Sequence:CCGGTCCGACCTCTAGACGCTTGTACTCGAGTACAAGCGTCTAGAGGTCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194284.2-1455s21c1
Sequence:CCGCTAACATGTTGAAACGACAATACTCGAGTATTGTCGTTTCAACATGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163161    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194284.1-1180s1c1
Sequence:CCGGGCAAACTCTCAAGAGGCCAATCTCGAGATTGGCCTCTTGAGAGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161659    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194284.1-1403s1c1
Sequence:CCGGGAGGAGAACAAAGGTCCTAATCTCGAGATTAGGACCTTTGTTCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161155    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194284.1-1211s1c1
Sequence:CCGGCCATGTTTGAATGAGCCTCTTCTCGAGAAGAGGCTCATTCAAACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194284.1-894s1c1
Sequence:CCGGCGATTAGTTCAGGTTGGGTTTCTCGAGAAACCCAACCTGAACTAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194284.1-1212s1c1
Sequence:CCGGCATGTTTGAATGAGCCTCTTACTCGAGTAAGAGGCTCATTCAAACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194284.1-1259s1c1
Sequence:CCGGCAGCAGCTTAATGGATTTCATCTCGAGATGAAATCCATTAAGCTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194284.1-1061s1c1
Sequence:CCGGGCAGTGCTCAGAAACAATTTACTCGAGTAAATTGTTTCTGAGCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194284.1-1181s1c1
Sequence:CCGGCAAACTCTCAAGAGGCCAATACTCGAGTATTGGCCTCTTGAGAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027998
CLDN23 MISSION shRNA Bacterial Glycerol Stock
claudin 23
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000089818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027998.2-1544s1c1
Sequence:CCGGGCCAGCAGCTTTAATGGCTTTCTCGAGAAAGCCATTAAAGCTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027998.2-968s1c1
Sequence:CCGGGCCACCCAAGTCCTACACCAACTCGAGTTGGTGTAGGACTTGGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027998.2-610s1c1
Sequence:CCGGCCTGGTATAACCACTTCTTGTCTCGAGACAAGAAGTGGTTATACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027998.2-407s1c1
Sequence:CCGGGCCCGACGAGTGGAACTACTTCTCGAGAAGTAGTTCCACTCGTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027998
CLDN23 MISSION shRNA shRNA Plasmid DNA
claudin 23
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000089818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027998.2-1544s1c1
Sequence:CCGGGCCAGCAGCTTTAATGGCTTTCTCGAGAAAGCCATTAAAGCTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027998.2-968s1c1
Sequence:CCGGGCCACCCAAGTCCTACACCAACTCGAGTTGGTGTAGGACTTGGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027998.2-610s1c1
Sequence:CCGGCCTGGTATAACCACTTCTTGTCTCGAGACAAGAAGTGGTTATACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027998.2-407s1c1
Sequence:CCGGGCCCGACGAGTGGAACTACTTCTCGAGAAGTAGTTCCACTCGTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027998
CLDN23 MISSION shRNA Lentiviral Transduction Particles
claudin 23
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000089818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027998.2-1544s1c1
Sequence:CCGGGCCAGCAGCTTTAATGGCTTTCTCGAGAAAGCCATTAAAGCTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027998.2-968s1c1
Sequence:CCGGGCCACCCAAGTCCTACACCAACTCGAGTTGGTGTAGGACTTGGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027998.2-610s1c1
Sequence:CCGGCCTGGTATAACCACTTCTTGTCTCGAGACAAGAAGTGGTTATACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027998.2-407s1c1
Sequence:CCGGGCCCGACGAGTGGAACTACTTCTCGAGAAGTAGTTCCACTCGTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)