EMAIL THIS PAGE TO A FRIEND

CLDN7

claudin 7

64 Gene Product Result for
Synonyms: CEPTRL2 CLDN-7 CPETRL2 Hs.84359 claudin-1
UniProtKB ID: O95471, B2R9X7, D3DTP0, Q6IPN3, Q7Z4Y7, Q9BVN0
Gene ID:
Human(1366) Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. Differential expression of this gene has been observed in different types of malignancies, including breast cancer, ovarian cancer, hepatocellular carcinomas, urinary tumors, prostate cancer, lung cancer, head and neck cancers, thyroid carcinomas, etc.. Alternatively spliced transcript variants encoding different isoforms have been found.[provided by RefSeq, May 2010]
Mouse(53624) claudin 7
Rat(65132) claudin 7
sheep(100462658) claudin 7
cow(512975) claudin 7
dog(489466) claudin 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016887 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016887 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016887 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001307 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001307 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001307 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001307 Rosetta Predictions human pricing
NM_031702 Rosetta Predictions rat pricing
NM_016887 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001307 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214821 predicted 527
2 SASI_Hs01_00214822 predicted 844
3 SASI_Hs02_00331587 predicted 845
4 SASI_Hs02_00331588 predicted 855
5 SASI_Hs01_00214824 predicted 574
6 SASI_Hs01_00214825 predicted 780
7 SASI_Hs02_00331589 predicted 856
8 SASI_Hs02_00331590 predicted 818
9 SASI_Hs02_00331591 predicted 981
10 SASI_Hs01_00214827 predicted 704
11 SASI_Hs01_00214820 predicted 834
12 SASI_Hs01_00214823 predicted 528
13 SASI_Hs01_00214826 predicted 669
14 SASI_Hs01_00214828 predicted 813
15 SASI_Hs01_00214829 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031702 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095681 predicted 465
2 SASI_Rn01_00095682 predicted 763
3 SASI_Rn02_00265057 predicted 776
4 SASI_Rn02_00265058 predicted 535
5 SASI_Rn02_00265059 predicted 388
6 SASI_Rn01_00095684 predicted 655
7 SASI_Rn01_00095685 predicted 544
8 SASI_Rn01_00095686 predicted 599
9 SASI_Rn01_00095689 predicted 444
10 SASI_Rn01_00095690 predicted 589
11 SASI_Rn01_00095683 predicted 720
12 SASI_Rn01_00095687 predicted 703
13 SASI_Rn01_00095688 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323710 predicted 884
2 SASI_Mm02_00323711 predicted 593
3 SASI_Mm02_00323712 predicted 839
4 SASI_Mm02_00323713 predicted 753
5 SASI_Mm02_00323714 predicted 816
6 SASI_Mm02_00323715 predicted 897
7 SASI_Mm02_00323716 predicted 698
8 SASI_Mm02_00323717 predicted 775
9 SASI_Mm02_00323718 predicted 767
10 SASI_Mm02_00323719 predicted 821
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016887
CLDN7 MISSION shRNA Bacterial Glycerol Stock
claudin 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016887.2-601s1c1
Sequence:CCGGCACCGGCATGATGAGCTGCAACTCGAGTTGCAGCTCATCATGCCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016887.2-883s1c1
Sequence:CCGGGACGCCCATGAACGTTAAGTACTCGAGTACTTAACGTTCATGGGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016887.2-1036s1c1
Sequence:CCGGGTCCAATTCCTCCAAGGAATACTCGAGTATTCCTTGGAGGAATTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016887.2-851s1c1
Sequence:CCGGCATCAGATTGTCACAGACTTTCTCGAGAAAGTCTGTGACAATCTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016887.2-991s1c1
Sequence:CCGGCAGTGAAAGCAAAGCTGCGTACTCGAGTACGCAGCTTTGCTTTCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016887
CLDN7 MISSION shRNA shRNA Plasmid DNA
claudin 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016887.2-601s1c1
Sequence:CCGGCACCGGCATGATGAGCTGCAACTCGAGTTGCAGCTCATCATGCCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016887.2-883s1c1
Sequence:CCGGGACGCCCATGAACGTTAAGTACTCGAGTACTTAACGTTCATGGGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016887.2-1036s1c1
Sequence:CCGGGTCCAATTCCTCCAAGGAATACTCGAGTATTCCTTGGAGGAATTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016887.2-851s1c1
Sequence:CCGGCATCAGATTGTCACAGACTTTCTCGAGAAAGTCTGTGACAATCTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016887.2-991s1c1
Sequence:CCGGCAGTGAAAGCAAAGCTGCGTACTCGAGTACGCAGCTTTGCTTTCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016887
CLDN7 MISSION shRNA Lentiviral Transduction Particles
claudin 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016887.2-601s1c1
Sequence:CCGGCACCGGCATGATGAGCTGCAACTCGAGTTGCAGCTCATCATGCCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016887.2-883s1c1
Sequence:CCGGGACGCCCATGAACGTTAAGTACTCGAGTACTTAACGTTCATGGGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016887.2-1036s1c1
Sequence:CCGGGTCCAATTCCTCCAAGGAATACTCGAGTATTCCTTGGAGGAATTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016887.2-851s1c1
Sequence:CCGGCATCAGATTGTCACAGACTTTCTCGAGAAAGTCTGTGACAATCTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016887.2-991s1c1
Sequence:CCGGCAGTGAAAGCAAAGCTGCGTACTCGAGTACGCAGCTTTGCTTTCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001307
CLDN7 MISSION shRNA Bacterial Glycerol Stock
claudin 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001307.3-1029s1c1
Sequence:CCGGCCCTAAGTCCAACTCTTCCAACTCGAGTTGGAAGAGTTGGACTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001307.3-849s1c1
Sequence:CCGGCCATCAGATTGTCACAGACTTCTCGAGAAGTCTGTGACAATCTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001307.3-876s1c1
Sequence:CCGGCCCTTTGATCCCTACCAACATCTCGAGATGTTGGTAGGGATCAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001307.3-522s1c1
Sequence:CCGGGAGCTCCTATGCGGGTGACAACTCGAGTTGTCACCCGCATAGGAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001307.3-782s1c1
Sequence:CCGGCCATGGGTGGAGGCATAATTTCTCGAGAAATTATGCCTCCACCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001307.4-758s21c1
Sequence:CCGGGGAGACGACAAAGTGAAGAAGCTCGAGCTTCTTCACTTTGTCGTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001307.4-1367s21c1
Sequence:CCGGGAACCTTAGTGCACCTACTTCCTCGAGGAAGTAGGTGCACTAAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001307
CLDN7 MISSION shRNA shRNA Plasmid DNA
claudin 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001307.3-1029s1c1
Sequence:CCGGCCCTAAGTCCAACTCTTCCAACTCGAGTTGGAAGAGTTGGACTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001307.3-849s1c1
Sequence:CCGGCCATCAGATTGTCACAGACTTCTCGAGAAGTCTGTGACAATCTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001307.3-876s1c1
Sequence:CCGGCCCTTTGATCCCTACCAACATCTCGAGATGTTGGTAGGGATCAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001307.3-522s1c1
Sequence:CCGGGAGCTCCTATGCGGGTGACAACTCGAGTTGTCACCCGCATAGGAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001307.3-782s1c1
Sequence:CCGGCCATGGGTGGAGGCATAATTTCTCGAGAAATTATGCCTCCACCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001307.4-758s21c1
Sequence:CCGGGGAGACGACAAAGTGAAGAAGCTCGAGCTTCTTCACTTTGTCGTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001307.4-1367s21c1
Sequence:CCGGGAACCTTAGTGCACCTACTTCCTCGAGGAAGTAGGTGCACTAAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001307
CLDN7 MISSION shRNA Lentiviral Transduction Particles
claudin 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001307.3-1029s1c1
Sequence:CCGGCCCTAAGTCCAACTCTTCCAACTCGAGTTGGAAGAGTTGGACTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001307.3-849s1c1
Sequence:CCGGCCATCAGATTGTCACAGACTTCTCGAGAAGTCTGTGACAATCTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001307.3-876s1c1
Sequence:CCGGCCCTTTGATCCCTACCAACATCTCGAGATGTTGGTAGGGATCAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001307.3-522s1c1
Sequence:CCGGGAGCTCCTATGCGGGTGACAACTCGAGTTGTCACCCGCATAGGAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001307.3-782s1c1
Sequence:CCGGCCATGGGTGGAGGCATAATTTCTCGAGAAATTATGCCTCCACCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001307.4-758s21c1
Sequence:CCGGGGAGACGACAAAGTGAAGAAGCTCGAGCTTCTTCACTTTGTCGTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001307.4-1367s21c1
Sequence:CCGGGAACCTTAGTGCACCTACTTCCTCGAGGAAGTAGGTGCACTAAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)