EMAIL THIS PAGE TO A FRIEND

CLEC2A

C-type lectin domain family 2, member A

21 Gene Product Result for
Synonyms: KACL PILAR UNQ5792
UniProtKB ID: Q6UVW9, A5Y4G5, A9QKS2, A9QKS3
Gene ID:
Human(387836) Summary: CLEC2A belongs to the CLEC2 family of activation-induced, natural killer gene complex-encoded C-type lectin-like receptors (Spreu et al., 2007 [PubMed 18046548]
cow(100847268) C-type lectin domain family 2, member A
domestic cat(101085219) C-type lectin domain family 2, member A
dog(100684268) C-type lectin domain family 2, member A
sheep(101102719) C-type lectin domain family 2, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207375 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207375 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207375 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207375 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048140 predicted 205
2 SASI_Hs01_00048141 predicted 205
3 SASI_Hs01_00048142 predicted 210
4 SASI_Hs01_00048143 predicted 208
5 SASI_Hs01_00048144 predicted 204
6 SASI_Hs01_00048145 predicted 660
7 SASI_Hs01_00048146 predicted 164
8 SASI_Hs01_00048147 predicted 315
9 SASI_Hs01_00048148 predicted 289
10 SASI_Hs01_00048149 predicted 346
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207375
CLEC2A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 2, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207375.1-175s1c1
Sequence:CCGGGCTAAACCTGTGGCATGTTCACTCGAGTGAACATGCCACAGGTTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207375.1-52s1c1
Sequence:CCGGGATGGCTTCATACATCGGATACTCGAGTATCCGATGTATGAAGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207375.1-105s1c1
Sequence:CCGGCCTTATGTGCTTCCTGAGTATCTCGAGATACTCAGGAAGCACATAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207375.1-246s1c1
Sequence:CCGGCAGAAATTGGACAGCCAGTAACTCGAGTTACTGGCTGTCCAATTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154957    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207375.1-549s1c1
Sequence:CCGGGTCAGCAGGAAGCAGTTAAATCTCGAGATTTAACTGCTTCCTGCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207375.1-386s1c1
Sequence:CCGGGAGATTCTTGGAAATGGACAACTCGAGTTGTCCATTTCCAAGAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207375.1-307s1c1
Sequence:CCGGGATACACAAGAAGACATGGAACTCGAGTTCCATGTCTTCTTGTGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207375.1-298s1c1
Sequence:CCGGGCTCAGATTGATACACAAGAACTCGAGTTCTTGTGTATCAATCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207375.1-425s1c1
Sequence:CCGGGTTGGCCATCAAACTCCAAATCTCGAGATTTGGAGTTTGATGGCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207375
CLEC2A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 2, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207375.1-175s1c1
Sequence:CCGGGCTAAACCTGTGGCATGTTCACTCGAGTGAACATGCCACAGGTTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207375.1-52s1c1
Sequence:CCGGGATGGCTTCATACATCGGATACTCGAGTATCCGATGTATGAAGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207375.1-105s1c1
Sequence:CCGGCCTTATGTGCTTCCTGAGTATCTCGAGATACTCAGGAAGCACATAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207375.1-246s1c1
Sequence:CCGGCAGAAATTGGACAGCCAGTAACTCGAGTTACTGGCTGTCCAATTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154957    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207375.1-549s1c1
Sequence:CCGGGTCAGCAGGAAGCAGTTAAATCTCGAGATTTAACTGCTTCCTGCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207375.1-386s1c1
Sequence:CCGGGAGATTCTTGGAAATGGACAACTCGAGTTGTCCATTTCCAAGAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207375.1-307s1c1
Sequence:CCGGGATACACAAGAAGACATGGAACTCGAGTTCCATGTCTTCTTGTGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207375.1-298s1c1
Sequence:CCGGGCTCAGATTGATACACAAGAACTCGAGTTCTTGTGTATCAATCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207375.1-425s1c1
Sequence:CCGGGTTGGCCATCAAACTCCAAATCTCGAGATTTGGAGTTTGATGGCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207375
CLEC2A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 2, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207375.1-175s1c1
Sequence:CCGGGCTAAACCTGTGGCATGTTCACTCGAGTGAACATGCCACAGGTTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207375.1-52s1c1
Sequence:CCGGGATGGCTTCATACATCGGATACTCGAGTATCCGATGTATGAAGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207375.1-105s1c1
Sequence:CCGGCCTTATGTGCTTCCTGAGTATCTCGAGATACTCAGGAAGCACATAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207375.1-246s1c1
Sequence:CCGGCAGAAATTGGACAGCCAGTAACTCGAGTTACTGGCTGTCCAATTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154957    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207375.1-549s1c1
Sequence:CCGGGTCAGCAGGAAGCAGTTAAATCTCGAGATTTAACTGCTTCCTGCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207375.1-386s1c1
Sequence:CCGGGAGATTCTTGGAAATGGACAACTCGAGTTGTCCATTTCCAAGAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207375.1-307s1c1
Sequence:CCGGGATACACAAGAAGACATGGAACTCGAGTTCCATGTCTTCTTGTGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207375.1-298s1c1
Sequence:CCGGGCTCAGATTGATACACAAGAACTCGAGTTCTTGTGTATCAATCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207375.1-425s1c1
Sequence:CCGGGTTGGCCATCAAACTCCAAATCTCGAGATTTGGAGTTTGATGGCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)