EMAIL THIS PAGE TO A FRIEND

CLEC2L

C-type lectin domain family 2, member L

62 Gene Product Result for
UniProtKB ID: P0C7M8
Gene ID:
Mouse(665180) C-type lectin domain family 2, member L
Rat(296985) C-type lectin domain family 2, member L
sheep(101110836) C-type lectin domain family 2, member L
naked mole-rat(101709025) C-type lectin domain family 2, member L
chicken(427735) C-type lectin domain family 2, member L
domestic cat(101090850) C-type lectin domain family 2, member L
dog(482773) C-type lectin domain family 2, member L
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101507 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001101507 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001101507 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080511 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080511 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080511 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080511 Rosetta Predictions human pricing
XM_498242 Rosetta Predictions human pricing
NM_001044233 Rosetta Predictions rat pricing
NM_001101507 Rosetta Predictions mouse pricing
XM_975103 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315547 predicted 1044
2 SASI_Hs02_00315548 predicted 876
3 SASI_Hs02_00315549 predicted 878
4 SASI_Hs02_00315550 predicted 831
5 SASI_Hs02_00315551 predicted 948
6 SASI_Hs02_00315552 predicted 859
7 SASI_Hs02_00315553 predicted 682
8 SASI_Hs02_00315554 predicted 557
9 SASI_Hs02_00315555 predicted 619
10 SASI_Hs02_00315556 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_498242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266668 predicted 497
2 SASI_Hs01_00266669 predicted 425
3 SASI_Hs01_00266670 predicted 460
4 SASI_Hs01_00266671 predicted 365
5 SASI_Hs01_00266672 predicted 432
6 SASI_Hs01_00266673 predicted 437
7 SASI_Hs01_00266674 predicted 466
8 SASI_Hs01_00266675 predicted 377
9 SASI_Hs01_00266676 predicted 460
10 SASI_Hs01_00266677 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044233 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205057 predicted 502
2 SASI_Rn02_00205058 predicted 274
3 SASI_Rn02_00205059 predicted 356
4 SASI_Rn02_00205060 predicted 682
5 SASI_Rn02_00205061 predicted 417
6 SASI_Rn02_00205062 predicted 303
7 SASI_Rn02_00205063 predicted 721
8 SASI_Rn02_00205064 predicted 480
9 SASI_Rn02_00205065 predicted 661
10 SASI_Rn02_00205066 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101507 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302537 predicted 783
2 SASI_Mm02_00302538 predicted 530
3 SASI_Mm02_00302539 predicted 690
4 SASI_Mm02_00302540 predicted 531
5 SASI_Mm02_00302541 predicted 737
6 SASI_Mm02_00302542 predicted 642
7 SASI_Mm02_00302543 predicted 585
8 SASI_Mm02_00302544 predicted 490
9 SASI_Mm02_00302545 predicted 484
10 SASI_Mm02_00302546 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975103 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242882 predicted 897
2 SASI_Mm01_00242883 predicted 640
3 SASI_Mm01_00242884 predicted 797
4 SASI_Mm01_00242885 predicted 636
5 SASI_Mm01_00242886 predicted 858
6 SASI_Mm01_00242887 predicted 753
7 SASI_Mm01_00242888 predicted 697
8 SASI_Mm01_00242889 predicted 603
9 SASI_Mm01_00242890 predicted 602
10 SASI_Mm01_00242891 predicted 902
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101507
CLEC2L MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 2, member L
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000240287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101507.1-779s21c1
Sequence:CCGGGTGCAGCAAGATGGCCTATACCTCGAGGTATAGGCCATCTTGCTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101507.1-675s21c1
Sequence:CCGGCCGTTTGACCCAGACACATTCCTCGAGGAATGTGTCTGGGTCAAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101507.1-997s21c1
Sequence:CCGGCTGTGGCCTAGCAGTTATATCCTCGAGGATATAACTGCTAGGCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101507.1-579s21c1
Sequence:GTACCGGCAGAAGGAACTGGAATTTATGCTCGAGCATAAATTCCAGTTCCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101507
CLEC2L MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 2, member L
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000240287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101507.1-779s21c1
Sequence:CCGGGTGCAGCAAGATGGCCTATACCTCGAGGTATAGGCCATCTTGCTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101507.1-675s21c1
Sequence:CCGGCCGTTTGACCCAGACACATTCCTCGAGGAATGTGTCTGGGTCAAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101507.1-997s21c1
Sequence:CCGGCTGTGGCCTAGCAGTTATATCCTCGAGGATATAACTGCTAGGCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101507.1-579s21c1
Sequence:GTACCGGCAGAAGGAACTGGAATTTATGCTCGAGCATAAATTCCAGTTCCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101507
CLEC2L MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 2, member L
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000240287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101507.1-779s21c1
Sequence:CCGGGTGCAGCAAGATGGCCTATACCTCGAGGTATAGGCCATCTTGCTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101507.1-675s21c1
Sequence:CCGGCCGTTTGACCCAGACACATTCCTCGAGGAATGTGTCTGGGTCAAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101507.1-997s21c1
Sequence:CCGGCTGTGGCCTAGCAGTTATATCCTCGAGGATATAACTGCTAGGCCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101507.1-579s21c1
Sequence:GTACCGGCAGAAGGAACTGGAATTTATGCTCGAGCATAAATTCCAGTTCCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080511
CLEC2L MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 2, member L
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080511.2-842s21c1
Sequence:CCGGCGTGTGGCTCAGCAGTTAAATCTCGAGATTTAACTGCTGAGCCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080511.2-420s21c1
Sequence:CCGGCCAGAAGGAGCTGGAATTTATCTCGAGATAAATTCCAGCTCCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080511.2-320s21c1
Sequence:CCGGACGGAAGGAAGTGCTACTTCTCTCGAGAGAAGTAGCACTTCCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080511.2-466s21c1
Sequence:CCGGTGGATTGGACTACGCAGAGTTCTCGAGAACTCTGCGTAGTCCAATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080511.2-621s21c1
Sequence:CCGGGTGCAGCAAGATGGCCTATACCTCGAGGTATAGGCCATCTTGCTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080511
CLEC2L MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 2, member L
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080511.2-842s21c1
Sequence:CCGGCGTGTGGCTCAGCAGTTAAATCTCGAGATTTAACTGCTGAGCCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080511.2-420s21c1
Sequence:CCGGCCAGAAGGAGCTGGAATTTATCTCGAGATAAATTCCAGCTCCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080511.2-320s21c1
Sequence:CCGGACGGAAGGAAGTGCTACTTCTCTCGAGAGAAGTAGCACTTCCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080511.2-466s21c1
Sequence:CCGGTGGATTGGACTACGCAGAGTTCTCGAGAACTCTGCGTAGTCCAATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080511.2-621s21c1
Sequence:CCGGGTGCAGCAAGATGGCCTATACCTCGAGGTATAGGCCATCTTGCTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080511
CLEC2L MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 2, member L
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080511.2-842s21c1
Sequence:CCGGCGTGTGGCTCAGCAGTTAAATCTCGAGATTTAACTGCTGAGCCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080511.2-420s21c1
Sequence:CCGGCCAGAAGGAGCTGGAATTTATCTCGAGATAAATTCCAGCTCCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080511.2-320s21c1
Sequence:CCGGACGGAAGGAAGTGCTACTTCTCTCGAGAGAAGTAGCACTTCCTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080511.2-466s21c1
Sequence:CCGGTGGATTGGACTACGCAGAGTTCTCGAGAACTCTGCGTAGTCCAATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080511.2-621s21c1
Sequence:CCGGGTGCAGCAAGATGGCCTATACCTCGAGGTATAGGCCATCTTGCTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)