EMAIL THIS PAGE TO A FRIEND

CLEC7A

C-type lectin domain family 7, member A

164 Gene Product Result for
Synonyms: BGR CANDF4 CLECSF12 DECTIN1
Gene ID:
Human(64581) Summary: This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. The encoded glycoprotein is a small type II membrane receptor with an extracellular C-type lectin-like domain fold and a cytoplasmic domain with an immunoreceptor tyrosine-based activation motif. It functions as a pattern-recognition receptor that recognizes a variety of beta-1,3-linked and beta-1,6-linked glucans from fungi and plants, and in this way plays a role in innate immune response. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
Mouse(56644) C-type lectin domain family 7, member a
Rat(502902) C-type lectin domain family 7, member A
domestic guinea pig(100725843) C-type lectin domain family 7, member A
naked mole-rat(101708518) C-type lectin domain family 7, member A
sheep(678685) C-type lectin domain family 7, member A
dog(611385) C-type lectin domain family 7, member A
cow(532865) C-type lectin domain family 7, member A
domestic cat(101083523) C-type lectin domain family 7, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020008 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020008 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020008 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022570 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022570 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022570 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022570 Rosetta Predictions human pricing
NM_197947 Rosetta Predictions human pricing
NM_197948 Rosetta Predictions human pricing
NM_197949 Rosetta Predictions human pricing
NM_197950 Rosetta Predictions human pricing
NM_197954 Rosetta Predictions human pricing
XM_001067977 Rosetta Predictions rat pricing
XM_578404 Rosetta Predictions rat pricing
NM_020008 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055042 predicted 412
2 SASI_Hs01_00055043 predicted 635
3 SASI_Hs01_00055044 predicted 437
4 SASI_Hs01_00055045 predicted 505
5 SASI_Hs01_00055046 predicted 523
6 SASI_Hs01_00055047 predicted 251
7 SASI_Hs01_00055048 predicted 646
8 SASI_Hs01_00055049 predicted 753
9 SASI_Hs01_00055050 predicted 722
10 SASI_Hs01_00055051 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064144 predicted 767
2 SASI_Hs01_00064145 predicted 583
3 SASI_Hs01_00064146 predicted 643
4 SASI_Hs01_00064147 predicted 465
5 SASI_Hs02_00371550 predicted 665
6 SASI_Hs01_00064148 predicted 248
7 SASI_Hs02_00371551 predicted 780
8 SASI_Hs01_00064149 predicted 891
9 SASI_Hs01_00064150 predicted 857
10 SASI_Hs01_00064152 predicted 596
11 SASI_Hs01_00064143 predicted 557
12 SASI_Hs01_00064151 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067914 predicted 547
2 SASI_Hs01_00067915 predicted 651
3 SASI_Hs01_00067916 predicted 574
4 SASI_Hs01_00067917 predicted 640
5 SASI_Hs01_00067918 predicted 469
6 SASI_Hs01_00067919 predicted 636
7 SASI_Hs01_00067920 predicted 256
8 SASI_Hs01_00067921 predicted 767
9 SASI_Hs01_00067922 predicted 746
10 SASI_Hs01_00067923 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205615 predicted 209
2 SASI_Hs01_00205617 predicted 514
3 SASI_Hs01_00205618 predicted 441
4 SASI_Hs01_00205619 predicted 500
5 SASI_Hs01_00205620 predicted 254
6 SASI_Hs01_00205621 predicted 263
7 SASI_Hs01_00205622 predicted 634
8 SASI_Hs01_00205623 predicted 604
9 SASI_Hs01_00205624 predicted 453
10 SASI_Hs02_00371552 predicted 423
11 SASI_Hs01_00205616 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217740 predicted 535
2 SASI_Hs01_00217741 predicted 340
3 SASI_Hs01_00217742 predicted 400
4 SASI_Hs02_00371553 predicted 424
5 SASI_Hs01_00217743 predicted 400
6 SASI_Hs01_00217744 predicted 254
7 SASI_Hs01_00217745 predicted 648
8 SASI_Hs01_00217746 predicted 622
9 SASI_Hs01_00217747 predicted 530
10 SASI_Hs01_00217748 predicted 352
11 SASI_Hs01_00217739 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114132 predicted 216
2 SASI_Hs01_00114133 predicted 240
3 SASI_Hs02_00371554 predicted 261
4 SASI_Hs01_00114134 predicted 258
5 SASI_Hs01_00114135 predicted 213
6 SASI_Hs01_00114136 predicted 261
7 SASI_Hs01_00114137 predicted 243
8 SASI_Hs01_00114139 predicted 251
9 SASI_Hs01_00114140 predicted 264
10 SASI_Hs02_00371555 predicted 227
11 SASI_Hs01_00114138 predicted 215
12 SASI_Hs01_00114141 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067977 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323026 predicted 577
2 SASI_Rn02_00323027 predicted 548
3 SASI_Rn02_00323028 predicted 366
4 SASI_Rn02_00323029 predicted 293
5 SASI_Rn02_00323030 predicted 311
6 SASI_Rn02_00323031 predicted 627
7 SASI_Rn02_00323032 predicted 383
8 SASI_Rn02_00323033 predicted 615
9 SASI_Rn02_00323034 predicted 479
10 SASI_Rn02_00323035 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578404 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407819 predicted 556
2 SASI_Rn02_00407820 predicted 372
3 SASI_Rn02_00407821 predicted 294
4 SASI_Rn02_00407822 predicted 473
5 SASI_Rn02_00407823 predicted 543
6 SASI_Rn02_00407824 predicted 382
7 SASI_Rn02_00407825 predicted 303
8 SASI_Rn02_00407826 predicted 486
9 SASI_Rn02_00407827 predicted 294
10 SASI_Rn02_00407828 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020008 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034306 predicted 497
2 SASI_Mm01_00034307 predicted 217
3 SASI_Mm01_00034308 predicted 539
4 SASI_Mm01_00034309 predicted 568
5 SASI_Mm01_00034310 predicted 368
6 SASI_Mm02_00325376 predicted 365
7 SASI_Mm01_00034311 predicted 470
8 SASI_Mm01_00034312 predicted 592
9 SASI_Mm01_00034313 predicted 1215
10 SASI_Mm02_00325377 predicted 1222
11 SASI_Mm01_00034314 predicted 1267
12 SASI_Mm01_00034315 predicted 1241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020008
CLEC7A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 7, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020008.1-298s1c1
Sequence:CCGGGCGACACAATTCAGGGAGAAACTCGAGTTTCTCCCTGAATTGTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020008.1-137s1c1
Sequence:CCGGCAATTAGACTTCAGCACTCAACTCGAGTTGAGTGCTGAAGTCTAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020008.1-690s1c1
Sequence:CCGGCCAACTCGTTTCAAGTCAGAACTCGAGTTCTGACTTGAAACGAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020008.1-783s1c1
Sequence:CCGGGCAATACTTCTTCATACAGTACTCGAGTACTGTATGAAGAAGTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020008.1-592s1c1
Sequence:CCGGCCAAACATCGTCTCACCGTATCTCGAGATACGGTGAGACGATGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020008
CLEC7A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 7, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020008.1-298s1c1
Sequence:CCGGGCGACACAATTCAGGGAGAAACTCGAGTTTCTCCCTGAATTGTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020008.1-137s1c1
Sequence:CCGGCAATTAGACTTCAGCACTCAACTCGAGTTGAGTGCTGAAGTCTAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020008.1-690s1c1
Sequence:CCGGCCAACTCGTTTCAAGTCAGAACTCGAGTTCTGACTTGAAACGAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020008.1-783s1c1
Sequence:CCGGGCAATACTTCTTCATACAGTACTCGAGTACTGTATGAAGAAGTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020008.1-592s1c1
Sequence:CCGGCCAAACATCGTCTCACCGTATCTCGAGATACGGTGAGACGATGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020008
CLEC7A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 7, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020008.1-298s1c1
Sequence:CCGGGCGACACAATTCAGGGAGAAACTCGAGTTTCTCCCTGAATTGTGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020008.1-137s1c1
Sequence:CCGGCAATTAGACTTCAGCACTCAACTCGAGTTGAGTGCTGAAGTCTAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020008.1-690s1c1
Sequence:CCGGCCAACTCGTTTCAAGTCAGAACTCGAGTTCTGACTTGAAACGAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020008.1-783s1c1
Sequence:CCGGGCAATACTTCTTCATACAGTACTCGAGTACTGTATGAAGAAGTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020008.1-592s1c1
Sequence:CCGGCCAAACATCGTCTCACCGTATCTCGAGATACGGTGAGACGATGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022570
CLEC7A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 7, member A
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000005317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022570.3-1429s1c1
Sequence:CCGGCCACGATTTGACCCTCAACTTCTCGAGAAGTTGAGGGTCAAATCGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022570.3-711s1c1
Sequence:CCGGCTGTGTAGTGTGCCCTCATATCTCGAGATATGAGGGCACACTACACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022570.3-204s1c1
Sequence:CCGGCAATTACACTTCGACTCTCAACTCGAGTTGAGAGTCGAAGTGTAATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022570.3-605s1c1
Sequence:CCGGTGGATCAACATTCTCTTCTAACTCGAGTTAGAAGAGAATGTTGATCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022570
CLEC7A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 7, member A
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000005317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022570.3-1429s1c1
Sequence:CCGGCCACGATTTGACCCTCAACTTCTCGAGAAGTTGAGGGTCAAATCGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022570.3-711s1c1
Sequence:CCGGCTGTGTAGTGTGCCCTCATATCTCGAGATATGAGGGCACACTACACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022570.3-204s1c1
Sequence:CCGGCAATTACACTTCGACTCTCAACTCGAGTTGAGAGTCGAAGTGTAATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022570.3-605s1c1
Sequence:CCGGTGGATCAACATTCTCTTCTAACTCGAGTTAGAAGAGAATGTTGATCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022570
CLEC7A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 7, member A
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000005317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022570.3-1429s1c1
Sequence:CCGGCCACGATTTGACCCTCAACTTCTCGAGAAGTTGAGGGTCAAATCGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022570.3-711s1c1
Sequence:CCGGCTGTGTAGTGTGCCCTCATATCTCGAGATATGAGGGCACACTACACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022570.3-204s1c1
Sequence:CCGGCAATTACACTTCGACTCTCAACTCGAGTTGAGAGTCGAAGTGTAATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022570.3-605s1c1
Sequence:CCGGTGGATCAACATTCTCTTCTAACTCGAGTTAGAAGAGAATGTTGATCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)