EMAIL THIS PAGE TO A FRIEND

CLIC5

chloride intracellular channel 5

158 Gene Product Result for
Synonyms: MST130 MSTP130
UniProtKB ID: Q9NZA1, B3KUF1, Q5T4Z0, Q8NBY3, Q96JT5, Q9BWZ0
Gene ID:
Human(53405) Summary: This gene encodes a member of the chloride intracellular channel (CLIC) family of chloride ion channels. The encoded protein associates with actin-based cytoskeletal structures and may play a role in multiple processes including hair cell stereocilia formation, myoblast proliferation and glomerular podocyte and endothelial cell maintenance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Mouse(224796) chloride intracellular channel 5
Rat(94272) chloride intracellular channel 5
sheep(101119340) chloride intracellular channel 5
domestic guinea pig(100733897) chloride intracellular channel 5
naked mole-rat(101722173) chloride intracellular channel 5
chicken(422054) chloride intracellular channel 5
cow(281696) chloride intracellular channel 5
Horse(100055661) chloride intracellular channel 5
dog(481822) chloride intracellular channel 5
domestic cat(101099207) chloride intracellular channel 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV35263 Anti-CLIC5 antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, bovine, canine, rabbit, pig, horse, mouse, zebrafish, human, rat
immunohistochemistry, western blot pricing
AV35262 Anti-CLIC5 antibody produced in rabbit IgG fraction of antiserum horse, mouse, pig, zebrafish, guinea pig, rat, human, bovine, rabbit, canine
immunohistochemistry, western blot pricing
SAB2106365 Anti-CLIC5 antibody produced in rabbit affinity isolated antibody horse, rabbit, guinea pig, human
ELISA, western blot pricing
SAB1402589 Monoclonal Anti-CLIC5 antibody produced in mouse clone 1E6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016929 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016929 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016929 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172621 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172621 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172621 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114086 Rosetta Predictions human pricing
NM_016929 Rosetta Predictions human pricing
NM_053603 Rosetta Predictions rat pricing
NM_172621 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326144 predicted 999
2 SASI_Hs02_00326145 predicted 1525
3 SASI_Hs02_00326146 predicted 1051
4 SASI_Hs02_00326147 predicted 1669
5 SASI_Hs02_00326148 predicted 1284
6 SASI_Hs02_00326149 predicted 1303
7 SASI_Hs02_00326150 predicted 1387
8 SASI_Hs02_00326151 predicted 1766
9 SASI_Hs02_00326152 predicted 1740
10 SASI_Hs02_00326153 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186857 predicted 729
2 SASI_Hs01_00186858 predicted 1256
3 SASI_Hs01_00186859 predicted 788
4 SASI_Hs02_00349912 predicted 1398
5 SASI_Hs02_00349913 predicted 1020
6 SASI_Hs01_00186861 predicted 1037
7 SASI_Hs01_00186862 predicted 1122
8 SASI_Hs02_00349914 predicted 1494
9 SASI_Hs02_00349915 predicted 1476
10 SASI_Hs01_00186864 predicted 708
11 SASI_Hs01_00186860 predicted 1262
12 SASI_Hs01_00186863 predicted 551
13 SASI_Hs01_00186865 predicted 1363
14 SASI_Hs01_00186866 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053603 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266292 predicted 1162
2 SASI_Rn02_00266293 predicted 1430
3 SASI_Rn02_00266294 predicted 1489
4 SASI_Rn02_00266295 predicted 849
5 SASI_Rn01_00040952 predicted 1298
6 SASI_Rn02_00266296 predicted 1162
7 SASI_Rn02_00266297 predicted 585
8 SASI_Rn02_00266298 predicted 827
9 SASI_Rn02_00266299 predicted 862
10 SASI_Rn02_00266300 predicted 1346
11 SASI_Rn01_00040945 predicted 1336
12 SASI_Rn01_00040946 predicted 734
13 SASI_Rn01_00040947 predicted 579
14 SASI_Rn01_00040948 predicted 976
15 SASI_Rn01_00040949 predicted 901
16 SASI_Rn01_00040950 predicted 1320
17 SASI_Rn01_00040951 predicted 1054
18 SASI_Rn01_00040953 predicted 884
19 SASI_Rn01_00040954 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172621 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190161 predicted 763
2 SASI_Mm01_00190162 predicted 793
3 SASI_Mm01_00190163 predicted 472
4 SASI_Mm01_00190164 predicted 901
5 SASI_Mm01_00190165 predicted 948
6 SASI_Mm01_00190166 predicted 1520
7 SASI_Mm01_00190167 predicted 935
8 SASI_Mm01_00190168 predicted 892
9 SASI_Mm01_00190169 predicted 926
10 SASI_Mm01_00190170 predicted 733
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016929
CLIC5 MISSION shRNA Bacterial Glycerol Stock
chloride intracellular channel 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016929.3-655s21c1
Sequence:CCGGACAGCGGGCATCGACATCTTTCTCGAGAAAGATGTCGATGCCCGCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016929.3-1503s21c1
Sequence:CCGGTCTTAGAAAGAGATCTATTACCTCGAGGTAATAGATCTCTTTCTAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016929.3-1377s21c1
Sequence:CCGGACTAGCTTCTTCTGCCAATATCTCGAGATATTGGCAGAAGAAGCTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016929.1-717s1c1
Sequence:CCGGCCTAACCAAGGCTCTAAAGAACTCGAGTTCTTTAGAGCCTTGGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016929.1-537s1c1
Sequence:CCGGCGTGAAGACAGACGTCAATAACTCGAGTTATTGACGTCTGTCTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016929.1-427s1c1
Sequence:CCGGCTGAAAGGAGTCGTGTTCAATCTCGAGATTGAACACGACTCCTTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016929.1-892s1c1
Sequence:CCGGGCCAAGAAATACCGCAACTATCTCGAGATAGTTGCGGTATTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016929.1-1015s1c1
Sequence:CCGGGCCTACGCTGATGTCGCCAAACTCGAGTTTGGCGACATCAGCGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016929
CLIC5 MISSION shRNA shRNA Plasmid DNA
chloride intracellular channel 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016929.3-655s21c1
Sequence:CCGGACAGCGGGCATCGACATCTTTCTCGAGAAAGATGTCGATGCCCGCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016929.3-1503s21c1
Sequence:CCGGTCTTAGAAAGAGATCTATTACCTCGAGGTAATAGATCTCTTTCTAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016929.3-1377s21c1
Sequence:CCGGACTAGCTTCTTCTGCCAATATCTCGAGATATTGGCAGAAGAAGCTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016929.1-717s1c1
Sequence:CCGGCCTAACCAAGGCTCTAAAGAACTCGAGTTCTTTAGAGCCTTGGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016929.1-537s1c1
Sequence:CCGGCGTGAAGACAGACGTCAATAACTCGAGTTATTGACGTCTGTCTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016929.1-427s1c1
Sequence:CCGGCTGAAAGGAGTCGTGTTCAATCTCGAGATTGAACACGACTCCTTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016929.1-892s1c1
Sequence:CCGGGCCAAGAAATACCGCAACTATCTCGAGATAGTTGCGGTATTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016929.1-1015s1c1
Sequence:CCGGGCCTACGCTGATGTCGCCAAACTCGAGTTTGGCGACATCAGCGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016929
CLIC5 MISSION shRNA Lentiviral Transduction Particles
chloride intracellular channel 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016929.3-655s21c1
Sequence:CCGGACAGCGGGCATCGACATCTTTCTCGAGAAAGATGTCGATGCCCGCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016929.3-1503s21c1
Sequence:CCGGTCTTAGAAAGAGATCTATTACCTCGAGGTAATAGATCTCTTTCTAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016929.3-1377s21c1
Sequence:CCGGACTAGCTTCTTCTGCCAATATCTCGAGATATTGGCAGAAGAAGCTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016929.1-717s1c1
Sequence:CCGGCCTAACCAAGGCTCTAAAGAACTCGAGTTCTTTAGAGCCTTGGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016929.1-537s1c1
Sequence:CCGGCGTGAAGACAGACGTCAATAACTCGAGTTATTGACGTCTGTCTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016929.1-427s1c1
Sequence:CCGGCTGAAAGGAGTCGTGTTCAATCTCGAGATTGAACACGACTCCTTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016929.1-892s1c1
Sequence:CCGGGCCAAGAAATACCGCAACTATCTCGAGATAGTTGCGGTATTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016929.1-1015s1c1
Sequence:CCGGGCCTACGCTGATGTCGCCAAACTCGAGTTTGGCGACATCAGCGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172621
CLIC5 MISSION shRNA Bacterial Glycerol Stock
chloride intracellular channel 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172621.1-911s1c1
Sequence:CCGGGCTAAGAAGTACCGAAACTATCTCGAGATAGTTTCGGTACTTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172621.1-367s1c1
Sequence:CCGGGCTCTTCGTGAAGGCTGGGATCTCGAGATCCCAGCCTTCACGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172621.1-962s1c1
Sequence:CCGGCGATACCTCAAGAATGCCTATCTCGAGATAGGCATTCTTGAGGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172621.1-707s1c1
Sequence:CCGGCAACAGAACAATGCTGCCCTTCTCGAGAAGGGCAGCATTGTTCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172621.1-530s1c1
Sequence:CCGGCCGCCCTTCCTGACCTTCAATCTCGAGATTGAAGGTCAGGAAGGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172621
CLIC5 MISSION shRNA shRNA Plasmid DNA
chloride intracellular channel 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172621.1-911s1c1
Sequence:CCGGGCTAAGAAGTACCGAAACTATCTCGAGATAGTTTCGGTACTTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172621.1-367s1c1
Sequence:CCGGGCTCTTCGTGAAGGCTGGGATCTCGAGATCCCAGCCTTCACGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172621.1-962s1c1
Sequence:CCGGCGATACCTCAAGAATGCCTATCTCGAGATAGGCATTCTTGAGGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172621.1-707s1c1
Sequence:CCGGCAACAGAACAATGCTGCCCTTCTCGAGAAGGGCAGCATTGTTCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172621.1-530s1c1
Sequence:CCGGCCGCCCTTCCTGACCTTCAATCTCGAGATTGAAGGTCAGGAAGGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172621
CLIC5 MISSION shRNA Lentiviral Transduction Particles
chloride intracellular channel 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172621.1-911s1c1
Sequence:CCGGGCTAAGAAGTACCGAAACTATCTCGAGATAGTTTCGGTACTTCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172621.1-367s1c1
Sequence:CCGGGCTCTTCGTGAAGGCTGGGATCTCGAGATCCCAGCCTTCACGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172621.1-962s1c1
Sequence:CCGGCGATACCTCAAGAATGCCTATCTCGAGATAGGCATTCTTGAGGTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172621.1-707s1c1
Sequence:CCGGCAACAGAACAATGCTGCCCTTCTCGAGAAGGGCAGCATTGTTCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172621.1-530s1c1
Sequence:CCGGCCGCCCTTCCTGACCTTCAATCTCGAGATTGAAGGTCAGGAAGGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)