EMAIL THIS PAGE TO A FRIEND

CNFN

cornifelin

72 Gene Product Result for
Synonyms: PLAC8L2
UniProtKB ID: Q9BYD5, B2R569
Gene ID:
Mouse(72383) cornifelin
Rat(365217) cornifelin
sheep(101104084) cornifelin
Zebrafish(447925) cornifelin
cow(785118) cornifelin-like
cow(511870) cornifelin
dog(612443) cornifelin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081375 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081375 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081375 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032488 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032488 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032488 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032488 Rosetta Predictions human pricing
NM_001108909 Rosetta Predictions rat pricing
NM_001081375 Rosetta Predictions mouse pricing
NM_028219 Rosetta Predictions mouse pricing
XM_485890 Rosetta Predictions mouse pricing
XM_902356 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020511 predicted 303
2 SASI_Hs02_00359947 predicted 199
3 SASI_Hs01_00020512 predicted 266
4 SASI_Hs01_00020513 predicted 282
5 SASI_Hs01_00020514 predicted 249
6 SASI_Hs01_00020515 predicted 222
7 SASI_Hs02_00359948 predicted 198
8 SASI_Hs01_00020516 predicted 268
9 SASI_Hs01_00020517 predicted 259
10 SASI_Hs01_00020518 predicted 206
11 SASI_Hs01_00020519 predicted 366
12 SASI_Hs01_00020520 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108909 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243285 predicted 388
2 SASI_Rn02_00243286 predicted 280
3 SASI_Rn02_00243287 predicted 275
4 SASI_Rn02_00243288 predicted 383
5 SASI_Rn02_00243289 predicted 258
6 SASI_Rn02_00243290 predicted 447
7 SASI_Rn02_00243291 predicted 343
8 SASI_Rn02_00243292 predicted 499
9 SASI_Rn02_00243293 predicted 265
10 SASI_Rn02_00243294 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297801 predicted 206
2 SASI_Mm02_00297802 predicted 307
3 SASI_Mm02_00297803 predicted 251
4 SASI_Mm02_00297804 predicted 258
5 SASI_Mm02_00297805 predicted 199
6 SASI_Mm02_00297806 predicted 200
7 SASI_Mm02_00297807 predicted 298
8 SASI_Mm02_00297808 predicted 285
9 SASI_Mm02_00297809 predicted 272
10 SASI_Mm02_00297810 predicted 193
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028219 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333534 predicted 253
2 SASI_Mm02_00333535 predicted 245
3 SASI_Mm02_00333536 predicted 358
4 SASI_Mm02_00333537 predicted 456
5 SASI_Mm02_00333538 predicted 236
6 SASI_Mm02_00333539 predicted 311
7 SASI_Mm02_00333540 predicted 259
8 SASI_Mm02_00333541 predicted 243
9 SASI_Mm02_00333542 predicted 278
10 SASI_Mm02_00333543 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218897 predicted 279
2 SASI_Mm01_00218898 predicted 351
3 SASI_Mm01_00218899 predicted 303
4 SASI_Mm01_00218900 predicted 304
5 SASI_Mm01_00218901 predicted 275
6 SASI_Mm01_00218902 predicted 277
7 SASI_Mm01_00218903 predicted 271
8 SASI_Mm01_00218904 predicted 343
9 SASI_Mm01_00218905 predicted 292
10 SASI_Mm01_00218906 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902356 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267400 predicted 206
2 SASI_Mm01_00267401 predicted 308
3 SASI_Mm01_00267402 predicted 256
4 SASI_Mm01_00267403 predicted 264
5 SASI_Mm01_00267404 predicted 212
6 SASI_Mm01_00267405 predicted 202
7 SASI_Mm01_00267406 predicted 310
8 SASI_Mm01_00267407 predicted 290
9 SASI_Mm01_00267408 predicted 281
10 SASI_Mm01_00267409 predicted 203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081375
CNFN MISSION shRNA Bacterial Glycerol Stock
cornifelin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081375.1-152s21c1
Sequence:CCGGTTGCAACGACATGCCCGTCTGCTCGAGCAGACGGGCATGTCGTTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081375.1-207s21c1
Sequence:CCGGTGCCGCATCTCCGATGACTTTCTCGAGAAAGTCATCGGAGATGCGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081375.1-109s21c1
Sequence:CCGGACCAGACACAGCTCAGCGATTCTCGAGAATCGCTGAGCTGTGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081375.1-284s21c1
Sequence:CCGGCATGAGGGAGCGCTACCACATCTCGAGATGTGGTAGCGCTCCCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081375.1-143s21c1
Sequence:CCGGCACCGACTGTTGCAACGACATCTCGAGATGTCGTTGCAACAGTCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081375
CNFN MISSION shRNA shRNA Plasmid DNA
cornifelin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081375.1-152s21c1
Sequence:CCGGTTGCAACGACATGCCCGTCTGCTCGAGCAGACGGGCATGTCGTTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081375.1-207s21c1
Sequence:CCGGTGCCGCATCTCCGATGACTTTCTCGAGAAAGTCATCGGAGATGCGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081375.1-109s21c1
Sequence:CCGGACCAGACACAGCTCAGCGATTCTCGAGAATCGCTGAGCTGTGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081375.1-284s21c1
Sequence:CCGGCATGAGGGAGCGCTACCACATCTCGAGATGTGGTAGCGCTCCCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081375.1-143s21c1
Sequence:CCGGCACCGACTGTTGCAACGACATCTCGAGATGTCGTTGCAACAGTCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081375
CNFN MISSION shRNA Lentiviral Transduction Particles
cornifelin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081375.1-152s21c1
Sequence:CCGGTTGCAACGACATGCCCGTCTGCTCGAGCAGACGGGCATGTCGTTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081375.1-207s21c1
Sequence:CCGGTGCCGCATCTCCGATGACTTTCTCGAGAAAGTCATCGGAGATGCGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081375.1-109s21c1
Sequence:CCGGACCAGACACAGCTCAGCGATTCTCGAGAATCGCTGAGCTGTGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081375.1-284s21c1
Sequence:CCGGCATGAGGGAGCGCTACCACATCTCGAGATGTGGTAGCGCTCCCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081375.1-143s21c1
Sequence:CCGGCACCGACTGTTGCAACGACATCTCGAGATGTCGTTGCAACAGTCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032488
CNFN MISSION shRNA Bacterial Glycerol Stock
cornifelin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032488.3-203s21c1
Sequence:CCGGTGCCGCATCTCCGACGACTTTCTCGAGAAAGTCGTCGGAGATGCGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032488.3-139s21c1
Sequence:CCGGCACGGACTGCTGCAACGACATCTCGAGATGTCGTTGCAGCAGTCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032488.3-373s21c1
Sequence:CCGGGGAACTGAAGATCCGAGAGTACTCGAGTACTCTCGGATCTTCAGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032488.3-154s21c1
Sequence:CCGGCGACATGCCTGTCTGTCTGTGCTCGAGCACAGACAGACAGGCATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032488.3-120s21c1
Sequence:CCGGGTGACTGGCACACAGGTCTCACTCGAGTGAGACCTGTGTGCCAGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032488
CNFN MISSION shRNA shRNA Plasmid DNA
cornifelin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032488.3-203s21c1
Sequence:CCGGTGCCGCATCTCCGACGACTTTCTCGAGAAAGTCGTCGGAGATGCGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032488.3-139s21c1
Sequence:CCGGCACGGACTGCTGCAACGACATCTCGAGATGTCGTTGCAGCAGTCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032488.3-373s21c1
Sequence:CCGGGGAACTGAAGATCCGAGAGTACTCGAGTACTCTCGGATCTTCAGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032488.3-154s21c1
Sequence:CCGGCGACATGCCTGTCTGTCTGTGCTCGAGCACAGACAGACAGGCATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032488.3-120s21c1
Sequence:CCGGGTGACTGGCACACAGGTCTCACTCGAGTGAGACCTGTGTGCCAGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032488
CNFN MISSION shRNA Lentiviral Transduction Particles
cornifelin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032488.3-203s21c1
Sequence:CCGGTGCCGCATCTCCGACGACTTTCTCGAGAAAGTCGTCGGAGATGCGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032488.3-139s21c1
Sequence:CCGGCACGGACTGCTGCAACGACATCTCGAGATGTCGTTGCAGCAGTCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032488.3-373s21c1
Sequence:CCGGGGAACTGAAGATCCGAGAGTACTCGAGTACTCTCGGATCTTCAGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032488.3-154s21c1
Sequence:CCGGCGACATGCCTGTCTGTCTGTGCTCGAGCACAGACAGACAGGCATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032488.3-120s21c1
Sequence:CCGGGTGACTGGCACACAGGTCTCACTCGAGTGAGACCTGTGTGCCAGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)