EMAIL THIS PAGE TO A FRIEND

CNNM1

cyclin M1

84 Gene Product Result for
Synonyms: ACDP1 CLP-1
UniProtKB ID: Q9NRU3, Q4QQG7, Q4QQH8, Q4QQP9, Q9NT45
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031396 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031396 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031396 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020348 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020348 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020348 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020348 Rosetta Predictions human pricing
NM_001107593 Rosetta Predictions rat pricing
NM_031396 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077238 predicted 1699
2 SASI_Hs02_00353282 predicted 1280
3 SASI_Hs01_00077240 predicted 2152
4 SASI_Hs01_00077241 predicted 2575
5 SASI_Hs02_00353283 predicted 1934
6 SASI_Hs01_00077242 predicted 2574
7 SASI_Hs01_00077243 predicted 1876
8 SASI_Hs01_00077245 predicted 1450
9 SASI_Hs01_00077246 predicted 2446
10 SASI_Hs02_00353284 predicted 2287
11 SASI_Hs01_00077239 predicted 1792
12 SASI_Hs01_00077244 predicted 1381
13 SASI_Hs01_00077247 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107593 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230365 predicted 1350
2 SASI_Rn02_00230366 predicted 1078
3 SASI_Rn02_00230367 predicted 820
4 SASI_Rn02_00230368 predicted 1279
5 SASI_Rn02_00230369 predicted 1038
6 SASI_Rn02_00230370 predicted 941
7 SASI_Rn02_00230371 predicted 1106
8 SASI_Rn02_00230372 predicted 658
9 SASI_Rn02_00230373 predicted 1508
10 SASI_Rn02_00230374 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173362 predicted 1592
2 SASI_Mm01_00173363 predicted 1792
3 SASI_Mm01_00173364 predicted 1550
4 SASI_Mm02_00337145 predicted 2260
5 SASI_Mm01_00173365 predicted 1519
6 SASI_Mm01_00173366 predicted 2320
7 SASI_Mm01_00173367 predicted 1711
8 SASI_Mm01_00173369 predicted 1434
9 SASI_Mm01_00173370 predicted 1797
10 SASI_Mm02_00337146 predicted 2694
11 SASI_Mm01_00173368 predicted 1169
12 SASI_Mm01_00173371 predicted 1342
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031396
CNNM1 MISSION shRNA Bacterial Glycerol Stock
cyclin M1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000451364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031396.2-1436s21c1
Sequence:CCGGTGGACATTCTGTTCGTCAAAGCTCGAGCTTTGACGAACAGAATGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000451477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031396.2-3130s21c1
Sequence:CCGGCATTCTGAGGCTCCCAATAATCTCGAGATTATTGGGAGCCTCAGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031396.2-2688s21c1
Sequence:CCGGGGATCCTGAATGCTGTAATATCTCGAGATATTACAGCATTCAGGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031396.1-2466s1c1
Sequence:CCGGCCATAGTTCATGCTTAGCATTCTCGAGAATGCTAAGCATGAACTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031396.1-996s1c1
Sequence:CCGGGCGGCATGATTTCTCTCTGTTCTCGAGAACAGAGAGAAATCATGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031396.1-1315s1c1
Sequence:CCGGGCCTTTACCTACTATGGTGTTCTCGAGAACACCATAGTAGGTAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031396.1-946s1c1
Sequence:CCGGCTCTACACTGACAATCGGAAACTCGAGTTTCCGATTGTCAGTGTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031396.1-1113s1c1
Sequence:CCGGCCTGTACCTTTCGGAGAAGATCTCGAGATCTTCTCCGAAAGGTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031396
CNNM1 MISSION shRNA shRNA Plasmid DNA
cyclin M1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000451364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031396.2-1436s21c1
Sequence:CCGGTGGACATTCTGTTCGTCAAAGCTCGAGCTTTGACGAACAGAATGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000451477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031396.2-3130s21c1
Sequence:CCGGCATTCTGAGGCTCCCAATAATCTCGAGATTATTGGGAGCCTCAGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031396.2-2688s21c1
Sequence:CCGGGGATCCTGAATGCTGTAATATCTCGAGATATTACAGCATTCAGGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031396.1-2466s1c1
Sequence:CCGGCCATAGTTCATGCTTAGCATTCTCGAGAATGCTAAGCATGAACTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031396.1-996s1c1
Sequence:CCGGGCGGCATGATTTCTCTCTGTTCTCGAGAACAGAGAGAAATCATGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031396.1-1315s1c1
Sequence:CCGGGCCTTTACCTACTATGGTGTTCTCGAGAACACCATAGTAGGTAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031396.1-946s1c1
Sequence:CCGGCTCTACACTGACAATCGGAAACTCGAGTTTCCGATTGTCAGTGTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031396.1-1113s1c1
Sequence:CCGGCCTGTACCTTTCGGAGAAGATCTCGAGATCTTCTCCGAAAGGTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031396
CNNM1 MISSION shRNA Lentiviral Transduction Particles
cyclin M1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000451364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031396.2-1436s21c1
Sequence:CCGGTGGACATTCTGTTCGTCAAAGCTCGAGCTTTGACGAACAGAATGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000451477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031396.2-3130s21c1
Sequence:CCGGCATTCTGAGGCTCCCAATAATCTCGAGATTATTGGGAGCCTCAGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031396.2-2688s21c1
Sequence:CCGGGGATCCTGAATGCTGTAATATCTCGAGATATTACAGCATTCAGGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031396.1-2466s1c1
Sequence:CCGGCCATAGTTCATGCTTAGCATTCTCGAGAATGCTAAGCATGAACTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031396.1-996s1c1
Sequence:CCGGGCGGCATGATTTCTCTCTGTTCTCGAGAACAGAGAGAAATCATGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031396.1-1315s1c1
Sequence:CCGGGCCTTTACCTACTATGGTGTTCTCGAGAACACCATAGTAGGTAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031396.1-946s1c1
Sequence:CCGGCTCTACACTGACAATCGGAAACTCGAGTTTCCGATTGTCAGTGTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031396.1-1113s1c1
Sequence:CCGGCCTGTACCTTTCGGAGAAGATCTCGAGATCTTCTCCGAAAGGTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020348
CNNM1 MISSION shRNA Bacterial Glycerol Stock
cyclin M1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020348.2-1878s21c1
Sequence:CCGGCCATTGTCCAGCGGGTGAATACTCGAGTATTCACCCGCTGGACAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020348.2-2403s21c1
Sequence:CCGGCCACTGCTTGCTCAGATAATGCTCGAGCATTATCTGAGCAAGCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020348.2-1838s21c1
Sequence:CCGGACGGTTCTGGAGGAGTTTAAGCTCGAGCTTAAACTCCTCCAGAACCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020348.1-526s1c1
Sequence:CCGGCGGCACAACATTGTGGACATTCTCGAGAATGTCCACAATGTTGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020348.1-1941s1c1
Sequence:CCGGCTCCAATTTAACACCTCTGATCTCGAGATCAGAGGTGTTAAATTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020348.1-874s1c1
Sequence:CCGGCGGCATGACTTCTCCTTGTTTCTCGAGAAACAAGGAGAAGTCATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020348.1-1707s1c1
Sequence:CCGGCCAGGAAGAAATGACTGACTTCTCGAGAAGTCAGTCATTTCTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020348.1-1023s1c1
Sequence:CCGGCCTGAAACATCCCAACGTGATCTCGAGATCACGTTGGGATGTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020348
CNNM1 MISSION shRNA shRNA Plasmid DNA
cyclin M1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020348.2-1878s21c1
Sequence:CCGGCCATTGTCCAGCGGGTGAATACTCGAGTATTCACCCGCTGGACAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020348.2-2403s21c1
Sequence:CCGGCCACTGCTTGCTCAGATAATGCTCGAGCATTATCTGAGCAAGCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020348.2-1838s21c1
Sequence:CCGGACGGTTCTGGAGGAGTTTAAGCTCGAGCTTAAACTCCTCCAGAACCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020348.1-526s1c1
Sequence:CCGGCGGCACAACATTGTGGACATTCTCGAGAATGTCCACAATGTTGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020348.1-1941s1c1
Sequence:CCGGCTCCAATTTAACACCTCTGATCTCGAGATCAGAGGTGTTAAATTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020348.1-874s1c1
Sequence:CCGGCGGCATGACTTCTCCTTGTTTCTCGAGAAACAAGGAGAAGTCATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020348.1-1707s1c1
Sequence:CCGGCCAGGAAGAAATGACTGACTTCTCGAGAAGTCAGTCATTTCTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020348.1-1023s1c1
Sequence:CCGGCCTGAAACATCCCAACGTGATCTCGAGATCACGTTGGGATGTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020348
CNNM1 MISSION shRNA Lentiviral Transduction Particles
cyclin M1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020348.2-1878s21c1
Sequence:CCGGCCATTGTCCAGCGGGTGAATACTCGAGTATTCACCCGCTGGACAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020348.2-2403s21c1
Sequence:CCGGCCACTGCTTGCTCAGATAATGCTCGAGCATTATCTGAGCAAGCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020348.2-1838s21c1
Sequence:CCGGACGGTTCTGGAGGAGTTTAAGCTCGAGCTTAAACTCCTCCAGAACCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020348.1-526s1c1
Sequence:CCGGCGGCACAACATTGTGGACATTCTCGAGAATGTCCACAATGTTGTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020348.1-1941s1c1
Sequence:CCGGCTCCAATTTAACACCTCTGATCTCGAGATCAGAGGTGTTAAATTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020348.1-874s1c1
Sequence:CCGGCGGCATGACTTCTCCTTGTTTCTCGAGAAACAAGGAGAAGTCATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020348.1-1707s1c1
Sequence:CCGGCCAGGAAGAAATGACTGACTTCTCGAGAAGTCAGTCATTTCTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020348.1-1023s1c1
Sequence:CCGGCCTGAAACATCCCAACGTGATCTCGAGATCACGTTGGGATGTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)