EMAIL THIS PAGE TO A FRIEND

COA5

cytochrome c oxidase assembly factor 5

71 Gene Product Result for
Synonyms: 6330578E17Rik C2orf64 Pet191
UniProtKB ID: Q86WW8
Gene ID:
Human(493753) Summary: This gene encodes an ortholog of yeast Pet191, which in yeast is a subunit of a large oligomeric complex associated with the mitochondrial inner membrane, and required for the assembly of the cytochrome c oxidase complex. Mutations in this gene are associated with mitochondrial complex IV deficiency, a disorder of the mitochondrial respiratory chain with heterogeneous clinical manifestations, ranging from isolated myopathy to a severe disease affecting several tissues and organs. [provided by RefSeq, Dec 2011]
Mouse(76178) cytochrome C oxidase assembly factor 5
Rat(503252) cytochrome C oxidase assembly factor 5
Zebrafish(751633) cytochrome C oxidase assembly factor 5
cow(614794) cytochrome c oxidase assembly factor 5
dog(611656) cytochrome C oxidase assembly factor 5
chicken(769722) cytochrome C oxidase assembly factor 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA057768 Anti-COA5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198006 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198006 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198006 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001008215 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008215 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008215 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU213061 MISSION® esiRNA esiRNA targeting mouse 6330578E17Rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008215 Rosetta Predictions human pricing
XM_001057297 Rosetta Predictions rat pricing
XM_578786 Rosetta Predictions rat pricing
NM_198006 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230198 predicted 210
2 SASI_Hs02_00305369 predicted 527
3 SASI_Hs01_00230199 predicted 443
4 SASI_Hs01_00230201 predicted 616
5 SASI_Hs02_00305370 predicted 214
6 SASI_Hs01_00230202 predicted 597
7 SASI_Hs01_00230203 predicted 602
8 SASI_Hs01_00230204 predicted 539
9 SASI_Hs01_00230205 predicted 230
10 SASI_Hs01_00230206 predicted 213
11 SASI_Hs01_00230200 predicted 594
12 SASI_Hs01_00230207 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285903 predicted 457
2 SASI_Rn02_00285904 predicted 620
3 SASI_Rn02_00285905 predicted 582
4 SASI_Rn02_00285906 predicted 480
5 SASI_Rn02_00285907 predicted 462
6 SASI_Rn02_00285908 predicted 492
7 SASI_Rn02_00285909 predicted 516
8 SASI_Rn02_00285910 predicted 446
9 SASI_Rn02_00285911 predicted 573
10 SASI_Rn02_00285912 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578786 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408326 predicted 457
2 SASI_Rn02_00408327 predicted 617
3 SASI_Rn02_00408328 predicted 580
4 SASI_Rn02_00408329 predicted 477
5 SASI_Rn02_00408330 predicted 463
6 SASI_Rn02_00408331 predicted 492
7 SASI_Rn02_00408332 predicted 509
8 SASI_Rn02_00408333 predicted 451
9 SASI_Rn02_00408334 predicted 573
10 SASI_Rn02_00408335 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198006 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350710 predicted 728
2 SASI_Mm02_00350711 predicted 613
3 SASI_Mm02_00350712 predicted 338
4 SASI_Mm02_00350713 predicted 487
5 SASI_Mm02_00350714 predicted 366
6 SASI_Mm02_00350715 predicted 707
7 SASI_Mm02_00350716 predicted 773
8 SASI_Mm02_00350717 predicted 710
9 SASI_Mm02_00350718 predicted 577
10 SASI_Mm02_00350719 predicted 302
11 SASI_Mm01_00146564 predicted 1303
12 SASI_Mm01_00146565 predicted 1374
13 SASI_Mm01_00146566 predicted 1345
14 SASI_Mm01_00146567 predicted 1318
15 SASI_Mm01_00146568 predicted 1668
16 SASI_Mm01_00146569 predicted 1374
17 SASI_Mm01_00146570 predicted 1423
18 SASI_Mm01_00146571 predicted 1660
19 SASI_Mm01_00146572 predicted 1387
20 SASI_Mm01_00146573 predicted 1460
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198006
VALIDATED
COA5 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase assembly factor 5
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198006.1-219s1c1
Sequence:CCGGGATCAATGCTGGATGCCAGATCTCGAGATCTGGCATCCAGCATTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198006.1-183s1c1
Sequence:CCGGGTAGAGCTTTGCAGTATTCCTCTCGAGAGGAATACTGCAAAGCTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198006.1-178s1c1
Sequence:CCGGCAACTGTAGAGCTTTGCAGTACTCGAGTACTGCAAAGCTCTACAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198006.3-220s21c1
Sequence:CCGGACTGTAGAGCTTTGCAGTATTCTCGAGAATACTGCAAAGCTCTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215448    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198006.3-2957s1c1
Sequence:CCGGGAATACCATGAAGGTTCATATCTCGAGATATGAACCTTCATGGTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217152    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198006.3-3108s1c1
Sequence:CCGGCTATGCTGTGAACGTGTATATCTCGAGATATACACGTTCACAGCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198006.3-307s1c1
Sequence:CCGGGATAACATGCTGAACGCAAGACTCGAGTCTTGCGTTCAGCATGTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198006.3-133s21c1
Sequence:CCGGTGAAGGAGGATCTGGGTGCATCTCGAGATGCACCCAGATCCTCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264741    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198006.3-1927s21c1
Sequence:CCGGATCATGACGGCCTCAATTATACTCGAGTATAATTGAGGCCGTCATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198006.3-267s21c1
Sequence:CCGGCTGGATGCCAGATCAAGATTCCTCGAGGAATCTTGATCTGGCATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198006.3-308s21c1
Sequence:CCGGATAACATGCTGAACGCAAGATCTCGAGATCTTGCGTTCAGCATGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198006
VALIDATED
COA5 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase assembly factor 5
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198006.1-219s1c1
Sequence:CCGGGATCAATGCTGGATGCCAGATCTCGAGATCTGGCATCCAGCATTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198006.1-183s1c1
Sequence:CCGGGTAGAGCTTTGCAGTATTCCTCTCGAGAGGAATACTGCAAAGCTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198006.1-178s1c1
Sequence:CCGGCAACTGTAGAGCTTTGCAGTACTCGAGTACTGCAAAGCTCTACAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198006.3-220s21c1
Sequence:CCGGACTGTAGAGCTTTGCAGTATTCTCGAGAATACTGCAAAGCTCTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215448    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198006.3-2957s1c1
Sequence:CCGGGAATACCATGAAGGTTCATATCTCGAGATATGAACCTTCATGGTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217152    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198006.3-3108s1c1
Sequence:CCGGCTATGCTGTGAACGTGTATATCTCGAGATATACACGTTCACAGCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198006.3-307s1c1
Sequence:CCGGGATAACATGCTGAACGCAAGACTCGAGTCTTGCGTTCAGCATGTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198006.3-133s21c1
Sequence:CCGGTGAAGGAGGATCTGGGTGCATCTCGAGATGCACCCAGATCCTCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264741    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198006.3-1927s21c1
Sequence:CCGGATCATGACGGCCTCAATTATACTCGAGTATAATTGAGGCCGTCATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198006.3-267s21c1
Sequence:CCGGCTGGATGCCAGATCAAGATTCCTCGAGGAATCTTGATCTGGCATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198006.3-308s21c1
Sequence:CCGGATAACATGCTGAACGCAAGATCTCGAGATCTTGCGTTCAGCATGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198006
VALIDATED
COA5 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase assembly factor 5
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198006.1-219s1c1
Sequence:CCGGGATCAATGCTGGATGCCAGATCTCGAGATCTGGCATCCAGCATTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198006.1-183s1c1
Sequence:CCGGGTAGAGCTTTGCAGTATTCCTCTCGAGAGGAATACTGCAAAGCTCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198006.1-178s1c1
Sequence:CCGGCAACTGTAGAGCTTTGCAGTACTCGAGTACTGCAAAGCTCTACAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198006.3-220s21c1
Sequence:CCGGACTGTAGAGCTTTGCAGTATTCTCGAGAATACTGCAAAGCTCTACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215448    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198006.3-2957s1c1
Sequence:CCGGGAATACCATGAAGGTTCATATCTCGAGATATGAACCTTCATGGTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217152    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198006.3-3108s1c1
Sequence:CCGGCTATGCTGTGAACGTGTATATCTCGAGATATACACGTTCACAGCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198006.3-307s1c1
Sequence:CCGGGATAACATGCTGAACGCAAGACTCGAGTCTTGCGTTCAGCATGTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198006.3-133s21c1
Sequence:CCGGTGAAGGAGGATCTGGGTGCATCTCGAGATGCACCCAGATCCTCCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264741    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198006.3-1927s21c1
Sequence:CCGGATCATGACGGCCTCAATTATACTCGAGTATAATTGAGGCCGTCATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198006.3-267s21c1
Sequence:CCGGCTGGATGCCAGATCAAGATTCCTCGAGGAATCTTGATCTGGCATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198006.3-308s21c1
Sequence:CCGGATAACATGCTGAACGCAAGATCTCGAGATCTTGCGTTCAGCATGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008215
VALIDATED
COA5 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase assembly factor 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164792    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008215.1-685s1c1
Sequence:CCGGCCTATCCAGAAGGTGTCTGTTCTCGAGAACAGACACCTTCTGGATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001008215.1-1387s1c1
Sequence:CCGGGCACTGAAGAATTACAAAGAACTCGAGTTCTTTGTAATTCTTCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161976    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008215.1-807s1c1
Sequence:CCGGGCTCTGATTCACTGAAGTAATCTCGAGATTACTTCAGTGAATCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001008215.1-228s1c1
Sequence:CCGGCAACTCTTTGAAGTACGCATTCTCGAGAATGCGTACTTCAAAGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001008215.1-204s1c1
Sequence:CCGGGCAGTGTTTGAAGGAAGGATACTCGAGTATCCTTCCTTCAAACACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008215.1-209s1c1
Sequence:CCGGGTTTGAAGGAAGGATACTGCACTCGAGTGCAGTATCCTTCCTTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008215.1-227s1c1
Sequence:CCGGGCAACTCTTTGAAGTACGCATCTCGAGATGCGTACTTCAAAGAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008215
VALIDATED
COA5 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase assembly factor 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164792    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008215.1-685s1c1
Sequence:CCGGCCTATCCAGAAGGTGTCTGTTCTCGAGAACAGACACCTTCTGGATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001008215.1-1387s1c1
Sequence:CCGGGCACTGAAGAATTACAAAGAACTCGAGTTCTTTGTAATTCTTCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161976    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008215.1-807s1c1
Sequence:CCGGGCTCTGATTCACTGAAGTAATCTCGAGATTACTTCAGTGAATCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001008215.1-228s1c1
Sequence:CCGGCAACTCTTTGAAGTACGCATTCTCGAGAATGCGTACTTCAAAGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001008215.1-204s1c1
Sequence:CCGGGCAGTGTTTGAAGGAAGGATACTCGAGTATCCTTCCTTCAAACACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008215.1-209s1c1
Sequence:CCGGGTTTGAAGGAAGGATACTGCACTCGAGTGCAGTATCCTTCCTTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008215.1-227s1c1
Sequence:CCGGGCAACTCTTTGAAGTACGCATCTCGAGATGCGTACTTCAAAGAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008215
VALIDATED
COA5 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase assembly factor 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164792    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008215.1-685s1c1
Sequence:CCGGCCTATCCAGAAGGTGTCTGTTCTCGAGAACAGACACCTTCTGGATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001008215.1-1387s1c1
Sequence:CCGGGCACTGAAGAATTACAAAGAACTCGAGTTCTTTGTAATTCTTCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161976    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008215.1-807s1c1
Sequence:CCGGGCTCTGATTCACTGAAGTAATCTCGAGATTACTTCAGTGAATCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001008215.1-228s1c1
Sequence:CCGGCAACTCTTTGAAGTACGCATTCTCGAGAATGCGTACTTCAAAGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001008215.1-204s1c1
Sequence:CCGGGCAGTGTTTGAAGGAAGGATACTCGAGTATCCTTCCTTCAAACACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008215.1-209s1c1
Sequence:CCGGGTTTGAAGGAAGGATACTGCACTCGAGTGCAGTATCCTTCCTTCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008215.1-227s1c1
Sequence:CCGGGCAACTCTTTGAAGTACGCATCTCGAGATGCGTACTTCAAAGAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)