EMAIL THIS PAGE TO A FRIEND

COL18A1-AS1

COL18A1 antisense RNA 1

83 Gene Product Result for
Synonyms: C21orf123 NCRNA00175 PRED80
Species: Human COL18A1-AS1(378832)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199175 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199175 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199175 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199175 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161789 predicted 454
2 SASI_Hs01_00161790 predicted 464
3 SASI_Hs01_00161791 predicted 369
4 SASI_Hs01_00161792 predicted 426
5 SASI_Hs01_00161793 predicted 360
6 SASI_Hs01_00161794 predicted 641
7 SASI_Hs01_00161795 predicted 1094
8 SASI_Hs01_00161796 predicted 778
9 SASI_Hs01_00161797 predicted 852
10 SASI_Hs01_00161798 predicted 834
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199175
COL18A1-AS1 MISSION shRNA Bacterial Glycerol Stock
COL18A1 antisense RNA 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199175.1-364s1c1
Sequence:CCGGCTGGCTTCTGCCATCTATTCTCTCGAGAGAATAGATGGCAGAAGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199175.1-373s1c1
Sequence:CCGGGCCATCTATTCTGTCCTGCAACTCGAGTTGCAGGACAGAATAGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167728    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199175.1-2075s1c1
Sequence:CCGGGATGGAAACAAATTCCTGTTTCTCGAGAAACAGGAATTTGTTTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199175.1-502s1c1
Sequence:CCGGCCAATCTAATTAACAGCATGACTCGAGTCATGCTGTTAATTAGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167283    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199175.1-1460s1c1
Sequence:CCGGCCTGGTTCTCTAGATATAATTCTCGAGAATTATATCTAGAGAACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199175.1-1427s1c1
Sequence:CCGGGCTGGATTAATGTCTAGACAACTCGAGTTGTCTAGACATTAATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199175
COL18A1-AS1 MISSION shRNA shRNA Plasmid DNA
COL18A1 antisense RNA 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199175.1-364s1c1
Sequence:CCGGCTGGCTTCTGCCATCTATTCTCTCGAGAGAATAGATGGCAGAAGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199175.1-373s1c1
Sequence:CCGGGCCATCTATTCTGTCCTGCAACTCGAGTTGCAGGACAGAATAGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167728    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199175.1-2075s1c1
Sequence:CCGGGATGGAAACAAATTCCTGTTTCTCGAGAAACAGGAATTTGTTTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199175.1-502s1c1
Sequence:CCGGCCAATCTAATTAACAGCATGACTCGAGTCATGCTGTTAATTAGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167283    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199175.1-1460s1c1
Sequence:CCGGCCTGGTTCTCTAGATATAATTCTCGAGAATTATATCTAGAGAACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199175.1-1427s1c1
Sequence:CCGGGCTGGATTAATGTCTAGACAACTCGAGTTGTCTAGACATTAATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199175
COL18A1-AS1 MISSION shRNA Lentiviral Transduction Particles
COL18A1 antisense RNA 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199175.1-364s1c1
Sequence:CCGGCTGGCTTCTGCCATCTATTCTCTCGAGAGAATAGATGGCAGAAGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199175.1-373s1c1
Sequence:CCGGGCCATCTATTCTGTCCTGCAACTCGAGTTGCAGGACAGAATAGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167728    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199175.1-2075s1c1
Sequence:CCGGGATGGAAACAAATTCCTGTTTCTCGAGAAACAGGAATTTGTTTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199175.1-502s1c1
Sequence:CCGGCCAATCTAATTAACAGCATGACTCGAGTCATGCTGTTAATTAGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167283    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199175.1-1460s1c1
Sequence:CCGGCCTGGTTCTCTAGATATAATTCTCGAGAATTATATCTAGAGAACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199175.1-1427s1c1
Sequence:CCGGGCTGGATTAATGTCTAGACAACTCGAGTTGTCTAGACATTAATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)