EMAIL THIS PAGE TO A FRIEND

COL1A1

collagen, type I, alpha 1

136 Gene Product Result for
Synonyms: OI4
Gene ID:
Human(1277) Summary: This gene encodes the pro-alpha1 chains of type I collagen whose triple helix comprises two alpha1 chains and one alpha2 chain. Type I is a fibril-forming collagen found in most connective tissues and is abundant in bone, cornea, dermis and tendon. Mutations in this gene are associated with osteogenesis imperfecta types I-IV, Ehlers-Danlos syndrome type VIIA, Ehlers-Danlos syndrome Classical type, Caffey Disease and idiopathic osteoporosis. Reciprocal translocations between chromosomes 17 and 22, where this gene and the gene for platelet-derived growth factor beta are located, are associated with a particular type of skin tumor called dermatofibrosarcoma protuberans, resulting from unregulated expression of the growth factor. Two transcripts, resulting from the use of alternate polyadenylation signals, have been identified for this gene. [provided by R. Dalgleish, Feb 2008]
Mouse(12842) collagen, type I, alpha 1
Rat(29393) collagen, type I, alpha 1
Goat(100860828) collagen, type I, alpha 1
sheep(443483) collagen, type I, alpha 1
Domestic Rabbit(100008952) collagen, type I, alpha 1
naked mole-rat(101703193) collagen, type I, alpha 1
domestic guinea pig(100733209) collagen, type I, alpha 1
chicken(395532) collagen, type I, alpha 1
dog(403651) collagen, type I, alpha 1
cow(282187) collagen, type I, alpha 1
Horse(100033877) collagen, type I, alpha 1
domestic cat(101092216) collagen, type I, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A4336 4-Aminobenzoyl-Gly-Pro-D-Leu-D-Ala hydroxamic acid ≥95% (HPLC) human, mouse, rat pricing
G5646 Gly-Arg-Gly-Asp-Thr-Pro ≥97% (HPLC) human, mouse, rat pricing

Proteins

Product # Description Species Add to Cart
 
C5858 Collagen-Fluorescein bovine collagenase substrate cow pricing
C4361 Collagen Type I−FITC Conjugate from bovine skin ~1 mg/mL, solution cow, human, mouse, rat pricing
C5983 Collagen from human lung Bornstein and Traub Type I, powder human pricing
C7624 Collagen human Bornstein and Traub Type I, recombinant, expressed in Nicotiana tabacum (tobacco) human pricing
C7999 Collagen human Bornstein and Traub Type I, recombinant, expressed in Nicotiana tabacum (tobacco) human pricing
C4243 Collagen solution from bovine skin BioReagent, suitable for cell culture, sterile-filtered human pricing
APREST71263 PrEST Antigen COL1A1 Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution human pricing
APREST71264 PrEST Antigen COL1A1 Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution human pricing
QPREST22514 SILuPrEST CO1A1 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
QPREST22515 SILuPrEST CO1A1 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
C7661 Collagen from rat tail Bornstein and Traub Type I, powder, BioReagent, suitable for cell culture rat pricing
C8897 Collagen from rat tail Bornstein and Traub Type I (Sigma Type VII), powder rat pricing
27666 Collagen from rat tail for cell biology, soluble rat pricing
C3867 Collagen, Type I solution from rat tail BioReagent, suitable for cell culture, sterile-filtered rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000088 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000088 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000088 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007742 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007742 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007742 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
AB745 Anti-Collagen Type I Antibody This Anti-Collagen Type I Antibody is validated for use in ELISA, IH, WB for the detection of Collagen Type I. pricing
AB749P Anti-Collagen Type I Antibody Anti-Collagen Type I Antibody detects level of Collagen Type I & has been published & validated for use in ELISA, RIA, IH, IH(P). pricing
AB752P Anti-Collagen Type I Antibody Detect Collagen Type I using this Anti-Collagen Type I Antibody validated for use in ELISA, RIA, IH. pricing
AB758 Anti-Collagen Type I Antibody Anti-Collagen Type I Antibody is an antibody against Collagen Type I for use in DB, ELISA, IC, IH & WB. pricing
ABT123 Anti-Collagen Type I Antibody Detect Collagen Type I using this Anti-Collagen Type I Antibody validated for use in Western Blotting, IHC(P), ELISA. pricing
AB758B Anti-Collagen Type I Antibody, biotin conjugated Anti-Collagen Type I Antibody, biotin conjugated is an antibody against Collagen Type Id for use in DB, ELISA, WB, IH. pricing
MAB3391 Anti-Collagen Type I Antibody, clone 5D8-G9 This Anti-Collagen Type I Antibody, clone 5D8-G9 is validated for use in ELISA, FC, WB, IH for the detection of Collagen Type I. pricing
MAB1340 Anti-Collagen Type I Antibody, clone C11 Detect Collagen Type I using this Anti-Collagen Type I Antibody, clone C11 validated for use in ELISA, IH. pricing
MAB1334 Anti-Collagen Types I, II & III Antibody, clone MMCHABC Anti-Collagen Types I, II & III Antibody, clone MMCHABC detects level of Collagen Types I & has been published & validated for use in ELISA, RIA, IH. pricing
AB765P Anti-Mouse Collagen Type I Antibody Anti-Mouse Collagen Type I Antibody detects level of Mouse Collagen Type I and has been published in over 20 citations and validated for use in ELISA, IH, RIA and WB. pricing
MAB1913 Anti-Procollagen Type I Antibody, CT, clone PCIDG10 This Anti-Procollagen Type I Antibody, C-terminus, clone PCIDG10 is validated for use in IH for the detection of Procollagen Type I. pricing
MAB1912 Anti-Procollagen Type I Antibody, NT, clone M-58 Detect Procollagen Type I using this Anti-Procollagen Type I Antibody, N-terminus, clone M-58 validated for use in IH(P). pricing
AB755P Anti-Rat Collagen Type I Antibody Anti-Rat Collagen Type I Antibody is an antibody against Collagen Type I for use in ELISA, IC, IH(P), RIA. pricing
08-115 Collagen Type I, rat tail pricing
CC050 Human Collagen Type I pricing
FCMAB412F Milli-Mark® Anti-Collagen Type I-FITC Antibody, clone 5D8-G9 Milli-Mark Anti-Collagen Type I-FITC Antibody, clone 5D8-G9 is an antibody against Collagen Type I for use in FC. pricing
ECM104 Millicoat™ Human Collagen Type I Coated Strips (96-Wells) 96-well plate coated with human Collagen Type I used for cell adhesion studies. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000088 Rosetta Predictions human pricing
NM_053304 Rosetta Predictions rat pricing
NM_007742 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301842 predicted 4049
2 SASI_Hs01_00182242 predicted 1319
3 SASI_Hs01_00182245 predicted 1682
4 SASI_Hs02_00301843 predicted 232
5 SASI_Hs01_00182248 predicted 2235
6 SASI_Hs01_00182251 predicted 229
7 SASI_Hs02_00301844 predicted 3784
8 SASI_Hs02_00301845 predicted 3981
9 SASI_Hs02_00301846 predicted 319
10 SASI_Hs02_00301847 predicted 4111
11 SASI_Hs01_00182243 predicted 3979
12 SASI_Hs01_00182244 predicted 1480
13 SASI_Hs01_00182246 predicted 306
14 SASI_Hs01_00182247 predicted 3969
15 SASI_Hs01_00182249 predicted 2334
16 SASI_Hs01_00182250 predicted 1165
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053304 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265696 predicted 3696
2 SASI_Rn02_00265697 predicted 1268
3 SASI_Rn02_00265698 predicted 3701
4 SASI_Rn02_00265699 predicted 1626
5 SASI_Rn02_00265700 predicted 4183
6 SASI_Rn02_00265701 predicted 3656
7 SASI_Rn02_00265702 predicted 3997
8 SASI_Rn02_00265703 predicted 4206
9 SASI_Rn02_00265704 predicted 244
10 SASI_Rn02_00265705 predicted 2327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007742 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070753 predicted 1259
2 SASI_Mm01_00070754 predicted 4166
3 SASI_Mm01_00070755 predicted 233
4 SASI_Mm01_00070756 predicted 1614
5 SASI_Mm01_00070757 predicted 3986
6 SASI_Mm01_00070759 predicted 2312
7 SASI_Mm01_00070760 predicted 4053
8 SASI_Mm01_00070761 predicted 354
9 SASI_Mm01_00070762 predicted 532
10 SASI_Mm02_00312341 predicted 531
11 SASI_Mm01_00070758 predicted 2868
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000088
COL1A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type I, alpha 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000088.3-3429s21c1
Sequence:CCGGACAGGGCGACAGAGGCATAAACTCGAGTTTATGCCTCTGTCGCCCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000088.3-4393s21c1
Sequence:CCGGGGCAAGACAGTGATTGAATACCTCGAGGTATTCAATCACTGTCTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000088.2-795s1c1
Sequence:CCGGCCTGGAAAGAATGGAGATGATCTCGAGATCATCTCCATTCTTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000088.2-4112s1c1
Sequence:CCGGCGATGGATTCCAGTTCGAGTACTCGAGTACTCGAACTGGAATCCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000088.2-2673s1c1
Sequence:CCGGCCCATTGGTAATGTTGGTGCTCTCGAGAGCACCAACATTACCAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000088.2-623s1c1
Sequence:CCGGTGAGAAATCAACCGGAGGAATCTCGAGATTCCTCCGGTTGATTTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000088.2-1442s1c1
Sequence:CCGGCAAAGGAGACACTGGTGCTAACTCGAGTTAGCACCAGTGTCTCCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000088
COL1A1 MISSION shRNA shRNA Plasmid DNA
collagen, type I, alpha 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000088.3-3429s21c1
Sequence:CCGGACAGGGCGACAGAGGCATAAACTCGAGTTTATGCCTCTGTCGCCCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000088.3-4393s21c1
Sequence:CCGGGGCAAGACAGTGATTGAATACCTCGAGGTATTCAATCACTGTCTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000088.2-795s1c1
Sequence:CCGGCCTGGAAAGAATGGAGATGATCTCGAGATCATCTCCATTCTTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000088.2-4112s1c1
Sequence:CCGGCGATGGATTCCAGTTCGAGTACTCGAGTACTCGAACTGGAATCCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000088.2-2673s1c1
Sequence:CCGGCCCATTGGTAATGTTGGTGCTCTCGAGAGCACCAACATTACCAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000088.2-623s1c1
Sequence:CCGGTGAGAAATCAACCGGAGGAATCTCGAGATTCCTCCGGTTGATTTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000088.2-1442s1c1
Sequence:CCGGCAAAGGAGACACTGGTGCTAACTCGAGTTAGCACCAGTGTCTCCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000088
COL1A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type I, alpha 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000088.3-3429s21c1
Sequence:CCGGACAGGGCGACAGAGGCATAAACTCGAGTTTATGCCTCTGTCGCCCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000088.3-4393s21c1
Sequence:CCGGGGCAAGACAGTGATTGAATACCTCGAGGTATTCAATCACTGTCTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000088.2-795s1c1
Sequence:CCGGCCTGGAAAGAATGGAGATGATCTCGAGATCATCTCCATTCTTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000088.2-4112s1c1
Sequence:CCGGCGATGGATTCCAGTTCGAGTACTCGAGTACTCGAACTGGAATCCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000088.2-2673s1c1
Sequence:CCGGCCCATTGGTAATGTTGGTGCTCTCGAGAGCACCAACATTACCAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000088.2-623s1c1
Sequence:CCGGTGAGAAATCAACCGGAGGAATCTCGAGATTCCTCCGGTTGATTTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000088.2-1442s1c1
Sequence:CCGGCAAAGGAGACACTGGTGCTAACTCGAGTTAGCACCAGTGTCTCCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007742
VALIDATED
COL1A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type I, alpha 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007742.3-2551s21c1
Sequence:CCGGCCTGGTGATACTGGTGTTAAACTCGAGTTTAACACCAGTATCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007742.3-4518s21c1
Sequence:CCGGGAAACAGACGAACAACCCAAACTCGAGTTTGGGTTGTTCGTCTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007742.3-530s21c1
Sequence:CCGGGCCTTGGAGGAAACTTTGCTTCTCGAGAAGCAAAGTTTCCTCCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007742.3-236s21c1
Sequence:CCGGCCGAGGTATGCTTGATCTGTACTCGAGTACAGATCAAGCATACCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007742.2-4518s1c1
Sequence:CCGGGAAACAGACGAACAACCCAAACTCGAGTTTGGGTTGTTCGTCTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007742.2-3676s1c1
Sequence:CCGGCCACCTCAAGAGAAGTCTCAACTCGAGTTGAGACTTCTCTTGAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007742.2-2551s1c1
Sequence:CCGGCCTGGTGATACTGGTGTTAAACTCGAGTTTAACACCAGTATCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007742.2-530s1c1
Sequence:CCGGGCCTTGGAGGAAACTTTGCTTCTCGAGAAGCAAAGTTTCCTCCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007742.2-236s1c1
Sequence:CCGGCCGAGGTATGCTTGATCTGTACTCGAGTACAGATCAAGCATACCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007742
VALIDATED
COL1A1 MISSION shRNA shRNA Plasmid DNA
collagen, type I, alpha 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007742.3-2551s21c1
Sequence:CCGGCCTGGTGATACTGGTGTTAAACTCGAGTTTAACACCAGTATCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007742.3-4518s21c1
Sequence:CCGGGAAACAGACGAACAACCCAAACTCGAGTTTGGGTTGTTCGTCTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007742.3-530s21c1
Sequence:CCGGGCCTTGGAGGAAACTTTGCTTCTCGAGAAGCAAAGTTTCCTCCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007742.3-236s21c1
Sequence:CCGGCCGAGGTATGCTTGATCTGTACTCGAGTACAGATCAAGCATACCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007742.2-4518s1c1
Sequence:CCGGGAAACAGACGAACAACCCAAACTCGAGTTTGGGTTGTTCGTCTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007742.2-3676s1c1
Sequence:CCGGCCACCTCAAGAGAAGTCTCAACTCGAGTTGAGACTTCTCTTGAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007742.2-2551s1c1
Sequence:CCGGCCTGGTGATACTGGTGTTAAACTCGAGTTTAACACCAGTATCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007742.2-530s1c1
Sequence:CCGGGCCTTGGAGGAAACTTTGCTTCTCGAGAAGCAAAGTTTCCTCCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007742.2-236s1c1
Sequence:CCGGCCGAGGTATGCTTGATCTGTACTCGAGTACAGATCAAGCATACCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007742
VALIDATED
COL1A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type I, alpha 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007742.3-2551s21c1
Sequence:CCGGCCTGGTGATACTGGTGTTAAACTCGAGTTTAACACCAGTATCACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007742.3-4518s21c1
Sequence:CCGGGAAACAGACGAACAACCCAAACTCGAGTTTGGGTTGTTCGTCTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007742.3-530s21c1
Sequence:CCGGGCCTTGGAGGAAACTTTGCTTCTCGAGAAGCAAAGTTTCCTCCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007742.3-236s21c1
Sequence:CCGGCCGAGGTATGCTTGATCTGTACTCGAGTACAGATCAAGCATACCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007742.2-4518s1c1
Sequence:CCGGGAAACAGACGAACAACCCAAACTCGAGTTTGGGTTGTTCGTCTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007742.2-3676s1c1
Sequence:CCGGCCACCTCAAGAGAAGTCTCAACTCGAGTTGAGACTTCTCTTGAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007742.2-2551s1c1
Sequence:CCGGCCTGGTGATACTGGTGTTAAACTCGAGTTTAACACCAGTATCACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007742.2-530s1c1
Sequence:CCGGGCCTTGGAGGAAACTTTGCTTCTCGAGAAGCAAAGTTTCCTCCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007742.2-236s1c1
Sequence:CCGGCCGAGGTATGCTTGATCTGTACTCGAGTACAGATCAAGCATACCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)