EMAIL THIS PAGE TO A FRIEND

COL24A1

collagen, type XXIV, alpha 1

154 Gene Product Result for
UniProtKB ID: Q17RW2, C9J1X6, Q14BD7, Q59EX5, Q5VY50, Q7Z5L5
Gene ID:
Mouse(71355) collagen, type XXIV, alpha 1
Rat(499723) collagen, type XXIV, alpha 1
chicken(424526) collagen, type XXIV, alpha 1
cow(531254) collagen, type XXIV, alpha 1
Horse(100063903) collagen, type XXIV, alpha 1
domestic cat(101092700) collagen, type XXIV, alpha 1
dog(479965) collagen, type XXIV, alpha 1
sheep(101114569) collagen, type XXIV, alpha 1
naked mole-rat(101710034) collagen, type XXIV, alpha 1
domestic guinea pig(100728661) collagen, type XXIV, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
WH0255631M7 Monoclonal Anti-COL24A1 antibody produced in mouse clone 1D8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152890 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152890 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152890 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_619970 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_619970 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_619970 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152890 Rosetta Predictions human pricing
XM_575056 Rosetta Predictions rat pricing
NM_027770 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239532 predicted 733
2 SASI_Hs02_00366854 predicted 1300
3 SASI_Hs01_00239533 predicted 4556
4 SASI_Hs01_00239534 predicted 4284
5 SASI_Hs02_00366855 predicted 295
6 SASI_Hs01_00239536 predicted 1580
7 SASI_Hs01_00239537 predicted 4646
8 SASI_Hs01_00239538 predicted 4730
9 SASI_Hs01_00239539 predicted 4664
10 SASI_Hs02_00366856 predicted 4543
11 SASI_Hs01_00239535 predicted 609
12 SASI_Hs01_00239540 predicted 1873
13 SASI_Hs01_00239541 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402970 predicted 742
2 SASI_Rn02_00402971 predicted 4522
3 SASI_Rn02_00402972 predicted 3894
4 SASI_Rn02_00402973 predicted 3866
5 SASI_Rn02_00402974 predicted 1345
6 SASI_Rn02_00402975 predicted 4413
7 SASI_Rn02_00402976 predicted 319
8 SASI_Rn02_00402977 predicted 362
9 SASI_Rn02_00402978 predicted 333
10 SASI_Rn02_00402979 predicted 3822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027770 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090322 predicted 1976
2 SASI_Mm02_00332712 predicted 1952
3 SASI_Mm01_00090323 predicted 1054
4 SASI_Mm01_00090325 predicted 5669
5 SASI_Mm02_00332713 predicted 2520
6 SASI_Mm01_00090326 predicted 5145
7 SASI_Mm01_00090327 predicted 5229
8 SASI_Mm01_00090329 predicted 1941
9 SASI_Mm01_00090330 predicted 1900
10 SASI_Mm02_00332714 predicted 888
11 SASI_Mm01_00090324 predicted 2102
12 SASI_Mm01_00090328 predicted 1633
13 SASI_Mm01_00090331 predicted 5286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152890
COL24A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XXIV, alpha 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152890.5-434s21c1
Sequence:CCGGTGCAATTAGGAGTACAATTACCTCGAGGTAATTGTACTCCTAATTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152890.5-4604s21c1
Sequence:CCGGTGAACTACCTTAGCAATTTATCTCGAGATAAATTGCTAAGGTAGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152890.5-874s21c1
Sequence:CCGGGTACTGTCAGAGGATACATTTCTCGAGAAATGTATCCTCTGACAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152890.4-5651s1c1
Sequence:CCGGCCGGTGATACACTACCTCTTACTCGAGTAAGAGGTAGTGTATCACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152890.4-765s1c1
Sequence:CCGGGCAGACAAATACCAACCTGAACTCGAGTTCAGGTTGGTATTTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152890.4-2742s1c1
Sequence:CCGGCCATTGGGATTACCTGGTCATCTCGAGATGACCAGGTAATCCCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152890.4-841s1c1
Sequence:CCGGCGCCCAAACTATTTGCTGAAACTCGAGTTTCAGCAAATAGTTTGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152890.4-4488s1c1
Sequence:CCGGGCTGCTATTCAAGCCTTGATTCTCGAGAATCAAGGCTTGAATAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152890
COL24A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XXIV, alpha 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152890.5-434s21c1
Sequence:CCGGTGCAATTAGGAGTACAATTACCTCGAGGTAATTGTACTCCTAATTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152890.5-4604s21c1
Sequence:CCGGTGAACTACCTTAGCAATTTATCTCGAGATAAATTGCTAAGGTAGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152890.5-874s21c1
Sequence:CCGGGTACTGTCAGAGGATACATTTCTCGAGAAATGTATCCTCTGACAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152890.4-5651s1c1
Sequence:CCGGCCGGTGATACACTACCTCTTACTCGAGTAAGAGGTAGTGTATCACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152890.4-765s1c1
Sequence:CCGGGCAGACAAATACCAACCTGAACTCGAGTTCAGGTTGGTATTTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152890.4-2742s1c1
Sequence:CCGGCCATTGGGATTACCTGGTCATCTCGAGATGACCAGGTAATCCCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152890.4-841s1c1
Sequence:CCGGCGCCCAAACTATTTGCTGAAACTCGAGTTTCAGCAAATAGTTTGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152890.4-4488s1c1
Sequence:CCGGGCTGCTATTCAAGCCTTGATTCTCGAGAATCAAGGCTTGAATAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152890
COL24A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XXIV, alpha 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152890.5-434s21c1
Sequence:CCGGTGCAATTAGGAGTACAATTACCTCGAGGTAATTGTACTCCTAATTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152890.5-4604s21c1
Sequence:CCGGTGAACTACCTTAGCAATTTATCTCGAGATAAATTGCTAAGGTAGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152890.5-874s21c1
Sequence:CCGGGTACTGTCAGAGGATACATTTCTCGAGAAATGTATCCTCTGACAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152890.4-5651s1c1
Sequence:CCGGCCGGTGATACACTACCTCTTACTCGAGTAAGAGGTAGTGTATCACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152890.4-765s1c1
Sequence:CCGGGCAGACAAATACCAACCTGAACTCGAGTTCAGGTTGGTATTTGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152890.4-2742s1c1
Sequence:CCGGCCATTGGGATTACCTGGTCATCTCGAGATGACCAGGTAATCCCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152890.4-841s1c1
Sequence:CCGGCGCCCAAACTATTTGCTGAAACTCGAGTTTCAGCAAATAGTTTGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152890.4-4488s1c1
Sequence:CCGGGCTGCTATTCAAGCCTTGATTCTCGAGAATCAAGGCTTGAATAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_619970
COL24A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XXIV, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_619970.1-1360s1c1
Sequence:CCGGCCCTAGAACTGAAATTGTATACTCGAGTATACAATTTCAGTTCTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619970.1-753s1c1
Sequence:CCGGGTTGGAGTTTGGAGTCAGCAACTCGAGTTGCTGACTCCAAACTCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619970.1-627s1c1
Sequence:CCGGGTACAAGGTTTCAGATGGAAACTCGAGTTTCCATCTGAAACCTTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619970.1-507s1c1
Sequence:CCGGCCACAGTTCAGACATATTCAACTCGAGTTGAATATGTCTGAACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619970.1-951s1c1
Sequence:CCGGCCTCTCAGATGACTGCAAGATCTCGAGATCTTGCAGTCATCTGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_619970
COL24A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XXIV, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_619970.1-1360s1c1
Sequence:CCGGCCCTAGAACTGAAATTGTATACTCGAGTATACAATTTCAGTTCTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619970.1-753s1c1
Sequence:CCGGGTTGGAGTTTGGAGTCAGCAACTCGAGTTGCTGACTCCAAACTCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619970.1-627s1c1
Sequence:CCGGGTACAAGGTTTCAGATGGAAACTCGAGTTTCCATCTGAAACCTTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619970.1-507s1c1
Sequence:CCGGCCACAGTTCAGACATATTCAACTCGAGTTGAATATGTCTGAACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619970.1-951s1c1
Sequence:CCGGCCTCTCAGATGACTGCAAGATCTCGAGATCTTGCAGTCATCTGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_619970
COL24A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XXIV, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_619970.1-1360s1c1
Sequence:CCGGCCCTAGAACTGAAATTGTATACTCGAGTATACAATTTCAGTTCTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619970.1-753s1c1
Sequence:CCGGGTTGGAGTTTGGAGTCAGCAACTCGAGTTGCTGACTCCAAACTCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619970.1-627s1c1
Sequence:CCGGGTACAAGGTTTCAGATGGAAACTCGAGTTTCCATCTGAAACCTTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619970.1-507s1c1
Sequence:CCGGCCACAGTTCAGACATATTCAACTCGAGTTGAATATGTCTGAACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619970.1-951s1c1
Sequence:CCGGCCTCTCAGATGACTGCAAGATCTCGAGATCTTGCAGTCATCTGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)