EMAIL THIS PAGE TO A FRIEND

COLEC11

collectin sub-family member 11

71 Gene Product Result for
Synonyms: 3MC2 CL-K1-I CL-K1-II CL-K1-IIa CL-K1-IIb CLK1
Gene ID:
Human(78989) Summary: This gene encodes a member of the collectin family of C-type lectins that possess collagen-like sequences and carbohydrate recognition domains. Collectins are secreted proteins that play important roles in the innate immune system by binding to carbohydrate antigens on microorganisms, facilitating their recognition and removal. The encoded protein binds to multiple sugars with a preference for fucose and mannose. Mutations in this gene are a cause of 3MC syndrome-2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Mouse(71693) collectin sub-family member 11
Rat(366588) collectin sub-family member 11
sheep(101120299) collectin sub-family member 11
naked mole-rat(101713454) collectin sub-family member 11
domestic guinea pig(100730989) collectin sub-family member 11
Zebrafish(492459) collectin sub-family member 11
cow(613991) collectin sub-family member 11
domestic cat(101091014) collectin sub-family member 11
dog(482958) collectin sub-family member 11
chicken(428649) collectin sub-family member 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024027 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024027 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024027 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027866 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027866 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027866 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024027 Rosetta Predictions human pricing
NM_199235 Rosetta Predictions human pricing
XM_345652 Rosetta Predictions rat pricing
NM_027866 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123870 predicted 921
2 SASI_Hs01_00123871 predicted 930
3 SASI_Hs01_00123872 predicted 929
4 SASI_Hs01_00123873 predicted 921
5 SASI_Hs01_00123874 predicted 837
6 SASI_Hs01_00123875 predicted 1079
7 SASI_Hs01_00123876 predicted 1073
8 SASI_Hs01_00123877 predicted 915
9 SASI_Hs01_00123878 predicted 597
10 SASI_Hs01_00123879 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229497 predicted 998
2 SASI_Hs01_00229498 predicted 1010
3 SASI_Hs01_00229499 predicted 1001
4 SASI_Hs01_00229500 predicted 620
5 SASI_Hs01_00229501 predicted 997
6 SASI_Hs01_00229502 predicted 920
7 SASI_Hs01_00229503 predicted 1152
8 SASI_Hs01_00229504 predicted 1147
9 SASI_Hs01_00229505 predicted 1002
10 SASI_Hs01_00229506 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345652 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00175463 predicted 428
2 SASI_Rn01_00175464 predicted 421
3 SASI_Rn01_00175465 predicted 512
4 SASI_Rn01_00175466 predicted 422
5 SASI_Rn01_00175467 predicted 420
6 SASI_Rn01_00175468 predicted 469
7 SASI_Rn01_00175469 predicted 513
8 SASI_Rn01_00175470 predicted 511
9 SASI_Rn01_00175471 predicted 509
10 SASI_Rn01_00175472 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027866 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112726 predicted 631
2 SASI_Mm02_00332825 predicted 836
3 SASI_Mm01_00112728 predicted 1081
4 SASI_Mm01_00112729 predicted 396
5 SASI_Mm01_00112730 predicted 406
6 SASI_Mm01_00112731 predicted 823
7 SASI_Mm01_00112732 predicted 1012
8 SASI_Mm01_00112733 predicted 1142
9 SASI_Mm01_00112735 predicted 708
10 SASI_Mm02_00332826 predicted 887
11 SASI_Mm01_00112727 predicted 839
12 SASI_Mm01_00112734 predicted 1113
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024027
COLEC11 MISSION shRNA Bacterial Glycerol Stock
collectin sub-family member 11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024027.3-364s1c1
Sequence:CCGGCAAAGGACAGAAAGGCAGTGTCTCGAGACACTGCCTTTCTGTCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024027.3-427s1c1
Sequence:CCGGGAAAGGAGATTCCGGTGACATCTCGAGATGTCACCGGAATCTCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159749    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024027.3-1093s1c1
Sequence:CCGGGCTGTTGTCTAAACTGAGAAACTCGAGTTTCTCAGTTTAGACAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024027.3-925s1c1
Sequence:CCGGCATGTACTTCATGTGTGAGTTCTCGAGAACTCACACATGAAGTACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158589    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024027.3-1162s1c1
Sequence:CCGGCTGAAGAAGCAGAGTTTCATTCTCGAGAATGAAACTCTGCTTCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024027.3-931s1c1
Sequence:CCGGCTTCATGTGTGAGTTTGACAACTCGAGTTGTCAAACTCACACATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024027.3-417s1c1
Sequence:CCGGCTAAAGGTGAGAAAGGAGATTCTCGAGAATCTCCTTTCTCACCTTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024027.3-1170s1c1
Sequence:CCGGGCAGAGTTTCATTACCTGTATCTCGAGATACAGGTAATGAAACTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024027.3-414s1c1
Sequence:CCGGGCTCTAAAGGTGAGAAAGGAGCTCGAGCTCCTTTCTCACCTTTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024027
COLEC11 MISSION shRNA shRNA Plasmid DNA
collectin sub-family member 11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024027.3-364s1c1
Sequence:CCGGCAAAGGACAGAAAGGCAGTGTCTCGAGACACTGCCTTTCTGTCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024027.3-427s1c1
Sequence:CCGGGAAAGGAGATTCCGGTGACATCTCGAGATGTCACCGGAATCTCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159749    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024027.3-1093s1c1
Sequence:CCGGGCTGTTGTCTAAACTGAGAAACTCGAGTTTCTCAGTTTAGACAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024027.3-925s1c1
Sequence:CCGGCATGTACTTCATGTGTGAGTTCTCGAGAACTCACACATGAAGTACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158589    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024027.3-1162s1c1
Sequence:CCGGCTGAAGAAGCAGAGTTTCATTCTCGAGAATGAAACTCTGCTTCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024027.3-931s1c1
Sequence:CCGGCTTCATGTGTGAGTTTGACAACTCGAGTTGTCAAACTCACACATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024027.3-417s1c1
Sequence:CCGGCTAAAGGTGAGAAAGGAGATTCTCGAGAATCTCCTTTCTCACCTTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024027.3-1170s1c1
Sequence:CCGGGCAGAGTTTCATTACCTGTATCTCGAGATACAGGTAATGAAACTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024027.3-414s1c1
Sequence:CCGGGCTCTAAAGGTGAGAAAGGAGCTCGAGCTCCTTTCTCACCTTTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024027
COLEC11 MISSION shRNA Lentiviral Transduction Particles
collectin sub-family member 11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024027.3-364s1c1
Sequence:CCGGCAAAGGACAGAAAGGCAGTGTCTCGAGACACTGCCTTTCTGTCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024027.3-427s1c1
Sequence:CCGGGAAAGGAGATTCCGGTGACATCTCGAGATGTCACCGGAATCTCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159749    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024027.3-1093s1c1
Sequence:CCGGGCTGTTGTCTAAACTGAGAAACTCGAGTTTCTCAGTTTAGACAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024027.3-925s1c1
Sequence:CCGGCATGTACTTCATGTGTGAGTTCTCGAGAACTCACACATGAAGTACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158589    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024027.3-1162s1c1
Sequence:CCGGCTGAAGAAGCAGAGTTTCATTCTCGAGAATGAAACTCTGCTTCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024027.3-931s1c1
Sequence:CCGGCTTCATGTGTGAGTTTGACAACTCGAGTTGTCAAACTCACACATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024027.3-417s1c1
Sequence:CCGGCTAAAGGTGAGAAAGGAGATTCTCGAGAATCTCCTTTCTCACCTTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024027.3-1170s1c1
Sequence:CCGGGCAGAGTTTCATTACCTGTATCTCGAGATACAGGTAATGAAACTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024027.3-414s1c1
Sequence:CCGGGCTCTAAAGGTGAGAAAGGAGCTCGAGCTCCTTTCTCACCTTTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027866
COLEC11 MISSION shRNA Bacterial Glycerol Stock
collectin sub-family member 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027866.1-862s21c1
Sequence:CCGGTGTACTTCATGTGCGAGTTTGCTCGAGCAAACTCGCACATGAAGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027866.1-430s21c1
Sequence:CCGGGTCAGCTGAGGAAGGCTATTGCTCGAGCAATAGCCTTCCTCAGCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027866.1-682s21c1
Sequence:CCGGGAGTCTTCATCGGTATCAATGCTCGAGCATTGATACCGATGAAGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027866.1-397s21c1
Sequence:CCGGCCAGTGGAGAACCTGGTATTCCTCGAGGAATACCAGGTTCTCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027866.1-1083s21c1
Sequence:CCGGTCTGAATAGGTGGCGTATTATCTCGAGATAATACGCCACCTATTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027866
COLEC11 MISSION shRNA shRNA Plasmid DNA
collectin sub-family member 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027866.1-862s21c1
Sequence:CCGGTGTACTTCATGTGCGAGTTTGCTCGAGCAAACTCGCACATGAAGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027866.1-430s21c1
Sequence:CCGGGTCAGCTGAGGAAGGCTATTGCTCGAGCAATAGCCTTCCTCAGCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027866.1-682s21c1
Sequence:CCGGGAGTCTTCATCGGTATCAATGCTCGAGCATTGATACCGATGAAGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027866.1-397s21c1
Sequence:CCGGCCAGTGGAGAACCTGGTATTCCTCGAGGAATACCAGGTTCTCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027866.1-1083s21c1
Sequence:CCGGTCTGAATAGGTGGCGTATTATCTCGAGATAATACGCCACCTATTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027866
COLEC11 MISSION shRNA Lentiviral Transduction Particles
collectin sub-family member 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027866.1-862s21c1
Sequence:CCGGTGTACTTCATGTGCGAGTTTGCTCGAGCAAACTCGCACATGAAGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027866.1-430s21c1
Sequence:CCGGGTCAGCTGAGGAAGGCTATTGCTCGAGCAATAGCCTTCCTCAGCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027866.1-682s21c1
Sequence:CCGGGAGTCTTCATCGGTATCAATGCTCGAGCATTGATACCGATGAAGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027866.1-397s21c1
Sequence:CCGGCCAGTGGAGAACCTGGTATTCCTCGAGGAATACCAGGTTCTCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027866.1-1083s21c1
Sequence:CCGGTCTGAATAGGTGGCGTATTATCTCGAGATAATACGCCACCTATTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)