EMAIL THIS PAGE TO A FRIEND
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139130 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139130 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139130 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032854 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032854 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032854 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146091 MISSION® esiRNA esiRNA human CORO6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032854 Rosetta Predictions human pricing
NM_139115 Rosetta Predictions rat pricing
NM_139128 Rosetta Predictions mouse pricing
NM_139129 Rosetta Predictions mouse pricing
NM_139130 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143624 predicted 1784
2 SASI_Hs01_00143625 predicted 1916
3 SASI_Hs01_00143626 predicted 1895
4 SASI_Hs01_00143627 predicted 1834
5 SASI_Hs01_00143628 predicted 1816
6 SASI_Hs01_00143629 predicted 916
7 SASI_Hs02_00360450 predicted 400
8 SASI_Hs01_00143631 predicted 944
9 SASI_Hs02_00360451 predicted 506
10 SASI_Hs02_00360452 predicted 610
11 SASI_Hs01_00143630 predicted 407
12 SASI_Hs01_00143632 predicted 419
13 SASI_Hs01_00143633 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101614 predicted 1064
2 SASI_Rn01_00101615 predicted 381
3 SASI_Rn01_00101617 predicted 819
4 SASI_Rn01_00101618 predicted 922
5 SASI_Rn01_00101619 predicted 1025
6 SASI_Rn01_00101622 predicted 532
7 SASI_Rn01_00101623 predicted 605
8 SASI_Rn02_00268503 predicted 922
9 SASI_Rn02_00268504 predicted 598
10 SASI_Rn02_00268505 predicted 1063
11 SASI_Rn01_00101616 predicted 1259
12 SASI_Rn01_00101620 predicted 472
13 SASI_Rn01_00101621 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139128 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106032 predicted 1016
2 SASI_Mm01_00106033 predicted 1037
3 SASI_Mm01_00106034 predicted 355
4 SASI_Mm01_00106035 predicted 1126
5 SASI_Mm01_00106036 predicted 302
6 SASI_Mm01_00106037 predicted 998
7 SASI_Mm01_00106038 predicted 357
8 SASI_Mm01_00106039 predicted 1066
9 SASI_Mm01_00106040 predicted 1033
10 SASI_Mm01_00106041 predicted 1003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139129 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155547 predicted 896
2 SASI_Mm01_00155548 predicted 917
3 SASI_Mm01_00155549 predicted 354
4 SASI_Mm01_00155550 predicted 1004
5 SASI_Mm01_00155551 predicted 305
6 SASI_Mm01_00155552 predicted 880
7 SASI_Mm01_00155553 predicted 351
8 SASI_Mm01_00155554 predicted 944
9 SASI_Mm01_00155555 predicted 918
10 SASI_Mm01_00155556 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139130 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179555 predicted 1011
2 SASI_Mm01_00179556 predicted 1046
3 SASI_Mm01_00179557 predicted 360
4 SASI_Mm01_00179558 predicted 1125
5 SASI_Mm01_00179559 predicted 309
6 SASI_Mm01_00179560 predicted 998
7 SASI_Mm01_00179561 predicted 355
8 SASI_Mm01_00179562 predicted 1065
9 SASI_Mm01_00179563 predicted 1037
10 SASI_Mm01_00179564 predicted 1002
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139130
CORO6 MISSION shRNA Bacterial Glycerol Stock
coronin 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139130.1-346s1c1
Sequence:CCGGCCTGTAAGAAACATCACAGAACTCGAGTTCTGTGATGTTTCTTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139130.1-906s1c1
Sequence:CCGGCGTGCATTATCTGAACACATTCTCGAGAATGTGTTCAGATAATGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139130.1-1020s1c1
Sequence:CCGGCGAACGAAAGTGTGAACCCATCTCGAGATGGGTTCACACTTTCGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139130.1-130s1c1
Sequence:CCGGCCCAAATTTCTAGCCATTATTCTCGAGAATAATGGCTAGAAATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139130.1-874s1c1
Sequence:CCGGCGGTACTTTGAAATTACGGAACTCGAGTTCCGTAATTTCAAAGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139130.2-791s21c1
Sequence:CCGGACACAAGCAACGGAGTGTTACCTCGAGGTAACACTCCGTTGCTTGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139130.2-587s21c1
Sequence:CCGGACAAGACCTTGCGCATCATTGCTCGAGCAATGATGCGCAAGGTCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139130.2-1209s21c1
Sequence:CCGGTCGGGTCACCAAACGCAACATCTCGAGATGTTGCGTTTGGTGACCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139130
CORO6 MISSION shRNA shRNA Plasmid DNA
coronin 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139130.1-346s1c1
Sequence:CCGGCCTGTAAGAAACATCACAGAACTCGAGTTCTGTGATGTTTCTTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139130.1-906s1c1
Sequence:CCGGCGTGCATTATCTGAACACATTCTCGAGAATGTGTTCAGATAATGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139130.1-1020s1c1
Sequence:CCGGCGAACGAAAGTGTGAACCCATCTCGAGATGGGTTCACACTTTCGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139130.1-130s1c1
Sequence:CCGGCCCAAATTTCTAGCCATTATTCTCGAGAATAATGGCTAGAAATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139130.1-874s1c1
Sequence:CCGGCGGTACTTTGAAATTACGGAACTCGAGTTCCGTAATTTCAAAGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139130.2-791s21c1
Sequence:CCGGACACAAGCAACGGAGTGTTACCTCGAGGTAACACTCCGTTGCTTGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139130.2-587s21c1
Sequence:CCGGACAAGACCTTGCGCATCATTGCTCGAGCAATGATGCGCAAGGTCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139130.2-1209s21c1
Sequence:CCGGTCGGGTCACCAAACGCAACATCTCGAGATGTTGCGTTTGGTGACCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139130
CORO6 MISSION shRNA Lentiviral Transduction Particles
coronin 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139130.1-346s1c1
Sequence:CCGGCCTGTAAGAAACATCACAGAACTCGAGTTCTGTGATGTTTCTTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139130.1-906s1c1
Sequence:CCGGCGTGCATTATCTGAACACATTCTCGAGAATGTGTTCAGATAATGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139130.1-1020s1c1
Sequence:CCGGCGAACGAAAGTGTGAACCCATCTCGAGATGGGTTCACACTTTCGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139130.1-130s1c1
Sequence:CCGGCCCAAATTTCTAGCCATTATTCTCGAGAATAATGGCTAGAAATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139130.1-874s1c1
Sequence:CCGGCGGTACTTTGAAATTACGGAACTCGAGTTCCGTAATTTCAAAGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139130.2-791s21c1
Sequence:CCGGACACAAGCAACGGAGTGTTACCTCGAGGTAACACTCCGTTGCTTGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139130.2-587s21c1
Sequence:CCGGACAAGACCTTGCGCATCATTGCTCGAGCAATGATGCGCAAGGTCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139130.2-1209s21c1
Sequence:CCGGTCGGGTCACCAAACGCAACATCTCGAGATGTTGCGTTTGGTGACCCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032854
CORO6 MISSION shRNA Bacterial Glycerol Stock
coronin 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032854.1-681s1c1
Sequence:CCGGTCTACAAGCTACACGAAAGAACTCGAGTTCTTTCGTGTAGCTTGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032854.1-883s1c1
Sequence:CCGGCCGGGTCACGAAGCGCAACATCTCGAGATGTTGCGCTTCGTGACCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032854.1-1402s1c1
Sequence:CCGGGCAGGGAAAGTGCTTAGTATTCTCGAGAATACTAAGCACTTTCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032854.1-786s1c1
Sequence:CCGGCGGCCCTAGAAGCGGACGAATCTCGAGATTCGTCCGCTTCTAGGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032854.1-536s1c1
Sequence:CCGGGACAGCAGCATTCGGTACTTTCTCGAGAAAGTACCGAATGCTGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032854.3-1789s21c1
Sequence:CCGGACCTCAAACGGGTGGCGATTTCTCGAGAAATCGCCACCCGTTTGAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032854.3-133s21c1
Sequence:CCCGCCAAATTCCTGGCCATTATTGCTCGAGCAATAATGGCCAGGAATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032854.3-589s21c1
Sequence:CCGGACAAGACCTTGCGCATCATTGCTCGAGCAATGATGCGCAAGGTCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032854
CORO6 MISSION shRNA shRNA Plasmid DNA
coronin 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032854.1-681s1c1
Sequence:CCGGTCTACAAGCTACACGAAAGAACTCGAGTTCTTTCGTGTAGCTTGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032854.1-883s1c1
Sequence:CCGGCCGGGTCACGAAGCGCAACATCTCGAGATGTTGCGCTTCGTGACCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032854.1-1402s1c1
Sequence:CCGGGCAGGGAAAGTGCTTAGTATTCTCGAGAATACTAAGCACTTTCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032854.1-786s1c1
Sequence:CCGGCGGCCCTAGAAGCGGACGAATCTCGAGATTCGTCCGCTTCTAGGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032854.1-536s1c1
Sequence:CCGGGACAGCAGCATTCGGTACTTTCTCGAGAAAGTACCGAATGCTGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032854.3-1789s21c1
Sequence:CCGGACCTCAAACGGGTGGCGATTTCTCGAGAAATCGCCACCCGTTTGAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032854.3-133s21c1
Sequence:CCCGCCAAATTCCTGGCCATTATTGCTCGAGCAATAATGGCCAGGAATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032854.3-589s21c1
Sequence:CCGGACAAGACCTTGCGCATCATTGCTCGAGCAATGATGCGCAAGGTCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032854
CORO6 MISSION shRNA Lentiviral Transduction Particles
coronin 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032854.1-681s1c1
Sequence:CCGGTCTACAAGCTACACGAAAGAACTCGAGTTCTTTCGTGTAGCTTGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032854.1-883s1c1
Sequence:CCGGCCGGGTCACGAAGCGCAACATCTCGAGATGTTGCGCTTCGTGACCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032854.1-1402s1c1
Sequence:CCGGGCAGGGAAAGTGCTTAGTATTCTCGAGAATACTAAGCACTTTCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032854.1-786s1c1
Sequence:CCGGCGGCCCTAGAAGCGGACGAATCTCGAGATTCGTCCGCTTCTAGGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032854.1-536s1c1
Sequence:CCGGGACAGCAGCATTCGGTACTTTCTCGAGAAAGTACCGAATGCTGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032854.3-1789s21c1
Sequence:CCGGACCTCAAACGGGTGGCGATTTCTCGAGAAATCGCCACCCGTTTGAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032854.3-133s21c1
Sequence:CCCGCCAAATTCCTGGCCATTATTGCTCGAGCAATAATGGCCAGGAATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032854.3-589s21c1
Sequence:CCGGACAAGACCTTGCGCATCATTGCTCGAGCAATGATGCGCAAGGTCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)