EMAIL THIS PAGE TO A FRIEND

COX5B

cytochrome c oxidase subunit Vb

57 Gene Product Result for
Synonyms: COXVB
UniProtKB ID: P10606, Q53YB7, Q96J18, Q99610
Gene ID:
Human(1329) Summary: Cytochrome C oxidase (COX) is the terminal enzyme of the mitochondrial respiratory chain. It is a multi-subunit enzyme complex that couples the transfer of electrons from cytochrome c to molecular oxygen and contributes to a proton electrochemical gradient across the inner mitochondrial membrane. The complex consists of 13 mitochondrial- and nuclear-encoded subunits. The mitochondrially-encoded subunits perform the electron transfer and proton pumping activities. The functions of the nuclear-encoded subunits are unknown but they may play a role in the regulation and assembly of the complex. This gene encodes the nuclear-encoded subunit Vb of the human mitochondrial respiratory chain enzyme. [provided by RefSeq, Jul 2008]
Mouse(12859) cytochrome c oxidase subunit Vb
Rat(94194) cytochrome c oxidase subunit Vb
cow(287012) cytochrome c oxidase subunit Vb
dog(474567) cytochrome c oxidase polypeptide Vb
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009942 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009942 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009942 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001862 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001862 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001862 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001862 Rosetta Predictions human pricing
NM_053586 Rosetta Predictions rat pricing
NM_009942 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190612 predicted 232
2 SASI_Hs01_00190607 predicted 269
3 SASI_Hs01_00190608 predicted 193
4 SASI_Hs02_00332695 predicted 239
5 SASI_Hs02_00332696 predicted 238
6 SASI_Hs01_00190609 predicted 270
7 SASI_Hs01_00190610 predicted 240
8 SASI_Hs01_00190611 predicted 241
9 SASI_Hs01_00190613 predicted 241
10 SASI_Hs01_00190614 predicted 240
11 SASI_Hs01_00190615 predicted 205
12 SASI_Hs01_00190616 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053586 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093153 predicted 258
2 SASI_Rn01_00093154 predicted 245
3 SASI_Rn01_00093155 predicted 255
4 SASI_Rn01_00093156 predicted 256
5 SASI_Rn01_00093157 predicted 251
6 SASI_Rn02_00266256 predicted 215
7 SASI_Rn01_00093158 predicted 254
8 SASI_Rn01_00093159 predicted 246
9 SASI_Rn01_00093160 predicted 217
10 SASI_Rn02_00266257 predicted 220
11 SASI_Rn01_00093161 predicted 250
12 SASI_Rn01_00093162 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009942 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133702 predicted 273
2 SASI_Mm02_00317497 predicted 338
3 SASI_Mm01_00133705 predicted 265
4 SASI_Mm01_00133706 predicted 267
5 SASI_Mm02_00317498 predicted 228
6 SASI_Mm02_00317499 predicted 339
7 SASI_Mm02_00317500 predicted 330
8 SASI_Mm01_00133709 predicted 329
9 SASI_Mm02_00317501 predicted 219
10 SASI_Mm02_00317502 predicted 267
11 SASI_Mm01_00133701 predicted 261
12 SASI_Mm01_00133703 predicted 258
13 SASI_Mm01_00133704 predicted 214
14 SASI_Mm01_00133707 predicted 256
15 SASI_Mm01_00133708 predicted 259
16 SASI_Mm01_00133710 predicted 270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009942
VALIDATED
COX5B MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit Vb
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009942.2-275s21c1
Sequence:CCGGCTGGACCCATACAATATGCTACTCGAGTAGCATATTGTATGGGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009942.2-317s21c1
Sequence:CCGGACCAAGGAAGACCCTAATCTACTCGAGTAGATTAGGGTCTTCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009942.2-215s21c1
Sequence:CCGGACTGATGAGGAGCAGGCTACTCTCGAGAGTAGCCTGCTCCTCATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009942.2-242s21c1
Sequence:CCGGGAGAGGGAGATCATGATAGCACTCGAGTGCTATCATGATCTCCCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009942.2-382s21c1
Sequence:CCGGAGAGGACAACTGTACTGTCATCTCGAGATGACAGTACAGTTGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009942.1-301s1c1
Sequence:CCGGCAAGAGAATAGTGGGCTGCATCTCGAGATGCAGCCCACTATTCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009942.1-328s1c1
Sequence:CCGGAGAGGACAACTGTACTGTCATCTCGAGATGACAGTACAGTTGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009942.1-221s1c1
Sequence:CCGGCTGGACCCATACAATATGCTACTCGAGTAGCATATTGTATGGGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009942.1-263s1c1
Sequence:CCGGACCAAGGAAGACCCTAATCTACTCGAGTAGATTAGGGTCTTCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009942.1-227s1c1
Sequence:CCGGCCATACAATATGCTACCTCCACTCGAGTGGAGGTAGCATATTGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009942
VALIDATED
COX5B MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit Vb
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009942.2-275s21c1
Sequence:CCGGCTGGACCCATACAATATGCTACTCGAGTAGCATATTGTATGGGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009942.2-317s21c1
Sequence:CCGGACCAAGGAAGACCCTAATCTACTCGAGTAGATTAGGGTCTTCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009942.2-215s21c1
Sequence:CCGGACTGATGAGGAGCAGGCTACTCTCGAGAGTAGCCTGCTCCTCATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009942.2-242s21c1
Sequence:CCGGGAGAGGGAGATCATGATAGCACTCGAGTGCTATCATGATCTCCCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009942.2-382s21c1
Sequence:CCGGAGAGGACAACTGTACTGTCATCTCGAGATGACAGTACAGTTGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009942.1-301s1c1
Sequence:CCGGCAAGAGAATAGTGGGCTGCATCTCGAGATGCAGCCCACTATTCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009942.1-328s1c1
Sequence:CCGGAGAGGACAACTGTACTGTCATCTCGAGATGACAGTACAGTTGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009942.1-221s1c1
Sequence:CCGGCTGGACCCATACAATATGCTACTCGAGTAGCATATTGTATGGGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009942.1-263s1c1
Sequence:CCGGACCAAGGAAGACCCTAATCTACTCGAGTAGATTAGGGTCTTCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009942.1-227s1c1
Sequence:CCGGCCATACAATATGCTACCTCCACTCGAGTGGAGGTAGCATATTGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009942
VALIDATED
COX5B MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit Vb
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009942.2-275s21c1
Sequence:CCGGCTGGACCCATACAATATGCTACTCGAGTAGCATATTGTATGGGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009942.2-317s21c1
Sequence:CCGGACCAAGGAAGACCCTAATCTACTCGAGTAGATTAGGGTCTTCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009942.2-215s21c1
Sequence:CCGGACTGATGAGGAGCAGGCTACTCTCGAGAGTAGCCTGCTCCTCATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009942.2-242s21c1
Sequence:CCGGGAGAGGGAGATCATGATAGCACTCGAGTGCTATCATGATCTCCCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009942.2-382s21c1
Sequence:CCGGAGAGGACAACTGTACTGTCATCTCGAGATGACAGTACAGTTGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009942.1-301s1c1
Sequence:CCGGCAAGAGAATAGTGGGCTGCATCTCGAGATGCAGCCCACTATTCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009942.1-328s1c1
Sequence:CCGGAGAGGACAACTGTACTGTCATCTCGAGATGACAGTACAGTTGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009942.1-221s1c1
Sequence:CCGGCTGGACCCATACAATATGCTACTCGAGTAGCATATTGTATGGGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009942.1-263s1c1
Sequence:CCGGACCAAGGAAGACCCTAATCTACTCGAGTAGATTAGGGTCTTCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009942.1-227s1c1
Sequence:CCGGCCATACAATATGCTACCTCCACTCGAGTGGAGGTAGCATATTGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001862
VALIDATED
COX5B MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit Vb
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001862.2-276s1c1
Sequence:CCGGATCTCCAACAAGAGAATAGTACTCGAGTACTATTCTCTTGTTGGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001862.2-301s1c1
Sequence:CCGGGCATCTGTGAAGAGGACAATACTCGAGTATTGTCCTCTTCACAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001862.2-161s1c1
Sequence:CCGGGACTGGGTTGGAGAGGGAGATCTCGAGATCTCCCTCTCCAACCCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001862.2-371s1c1
Sequence:CCGGCCGCTGTGGAGCCCATTACAACTCGAGTTGTAATGGGCTCCACAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001862.2-142s1c1
Sequence:CCGGCCACTGATGAAGAGCAGGCGACTCGAGTCGCCTGCTCTTCATCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001862
VALIDATED
COX5B MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit Vb
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001862.2-276s1c1
Sequence:CCGGATCTCCAACAAGAGAATAGTACTCGAGTACTATTCTCTTGTTGGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001862.2-301s1c1
Sequence:CCGGGCATCTGTGAAGAGGACAATACTCGAGTATTGTCCTCTTCACAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001862.2-161s1c1
Sequence:CCGGGACTGGGTTGGAGAGGGAGATCTCGAGATCTCCCTCTCCAACCCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001862.2-371s1c1
Sequence:CCGGCCGCTGTGGAGCCCATTACAACTCGAGTTGTAATGGGCTCCACAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001862.2-142s1c1
Sequence:CCGGCCACTGATGAAGAGCAGGCGACTCGAGTCGCCTGCTCTTCATCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001862
VALIDATED
COX5B MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit Vb
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001862.2-276s1c1
Sequence:CCGGATCTCCAACAAGAGAATAGTACTCGAGTACTATTCTCTTGTTGGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001862.2-301s1c1
Sequence:CCGGGCATCTGTGAAGAGGACAATACTCGAGTATTGTCCTCTTCACAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001862.2-161s1c1
Sequence:CCGGGACTGGGTTGGAGAGGGAGATCTCGAGATCTCCCTCTCCAACCCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001862.2-371s1c1
Sequence:CCGGCCGCTGTGGAGCCCATTACAACTCGAGTTGTAATGGGCTCCACAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001862.2-142s1c1
Sequence:CCGGCCACTGATGAAGAGCAGGCGACTCGAGTCGCCTGCTCTTCATCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)