EMAIL THIS PAGE TO A FRIEND

COX6B2

cytochrome c oxidase subunit VIb polypeptide 2 (testis)

57 Gene Product Result for
Synonyms: COXVIB2 CT59
UniProtKB ID: Q6YFQ2, Q7L1R4, Q96DL5
Gene ID:
Mouse(333182) cytochrome c oxidase subunit VIb polypeptide 2
Rat(654441) cytochrome c oxidase subunit VIb polypeptide 2
Zebrafish(393478) cytochrome c oxidase subunit VIb polypeptide 2
cow(503554) cytochrome c oxidase subunit VIb polypeptide 2 (testis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144613 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183405 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183405 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183405 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144613 Rosetta Predictions human pricing
NM_001039085 Rosetta Predictions rat pricing
NM_183405 Rosetta Predictions mouse pricing
NM_183406 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237965 predicted 540
2 SASI_Hs01_00237966 predicted 568
3 SASI_Hs01_00237967 predicted 757
4 SASI_Hs01_00237968 predicted 473
5 SASI_Hs01_00237969 predicted 253
6 SASI_Hs01_00237970 predicted 267
7 SASI_Hs01_00237972 predicted 551
8 SASI_Hs01_00237973 predicted 660
9 SASI_Hs01_00237974 predicted 571
10 SASI_Hs02_00364425 predicted 464
11 SASI_Hs01_00237971 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033851 predicted 241
2 SASI_Rn01_00033852 predicted 245
3 SASI_Rn01_00033853 predicted 206
4 SASI_Rn01_00033854 predicted 238
5 SASI_Rn01_00033856 predicted 235
6 SASI_Rn02_00204794 predicted 237
7 SASI_Rn01_00033857 predicted 240
8 SASI_Rn01_00033858 predicted 248
9 SASI_Rn01_00033859 predicted 234
10 SASI_Rn01_00033860 predicted 232
11 SASI_Rn01_00033855 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077121 predicted 321
2 SASI_Mm01_00077122 predicted 312
3 SASI_Mm01_00077123 predicted 314
4 SASI_Mm01_00077124 predicted 308
5 SASI_Mm01_00077126 predicted 323
6 SASI_Mm01_00077127 predicted 306
7 SASI_Mm01_00077128 predicted 214
8 SASI_Mm02_00350508 predicted 200
9 SASI_Mm01_00077129 predicted 310
10 SASI_Mm01_00077130 predicted 318
11 SASI_Mm01_00077125 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026125 predicted 219
2 SASI_Mm01_00026126 predicted 227
3 SASI_Mm01_00026127 predicted 226
4 SASI_Mm01_00026128 predicted 230
5 SASI_Mm01_00026129 predicted 216
6 SASI_Mm01_00026130 predicted 191
7 SASI_Mm01_00026131 predicted 235
8 SASI_Mm01_00026132 predicted 220
9 SASI_Mm01_00026133 predicted 235
10 SASI_Mm01_00026134 predicted 219
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144613
COX6B2 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIb polypeptide 2 (testis)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144613.3-233s1c1
Sequence:CCGGCGAGTACTATTTCCGCGTGTACTCGAGTACACGCGGAAATAGTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144613.3-136s1c1
Sequence:CCGGCCAGCCAGAACCAGATCCGTACTCGAGTACGGATCTGGTTCTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144613.3-161s1c1
Sequence:CCGGCTACCAGAACTTCCTGGACTACTCGAGTAGTCCAGGAAGTTCTGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144613.3-294s1c1
Sequence:CCGGGAGCAGATCAAGAACGGGATTCTCGAGAATCCCGTTCTTGATCTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144613.3-149s1c1
Sequence:CCGGGATCCGTAACTGCTACCAGAACTCGAGTTCTGGTAGCAGTTACGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144613.4-543s21c1
Sequence:CCGGAGTGTCTAAGCCACGAATAATCTCGAGATTATTCGTGGCTTAGACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144613.4-340s21c1
Sequence:CCGGACGCAGCCCTGCGAGTACTATCTCGAGATAGTACTCGCAGGGCTGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144613
COX6B2 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIb polypeptide 2 (testis)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144613.3-233s1c1
Sequence:CCGGCGAGTACTATTTCCGCGTGTACTCGAGTACACGCGGAAATAGTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144613.3-136s1c1
Sequence:CCGGCCAGCCAGAACCAGATCCGTACTCGAGTACGGATCTGGTTCTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144613.3-161s1c1
Sequence:CCGGCTACCAGAACTTCCTGGACTACTCGAGTAGTCCAGGAAGTTCTGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144613.3-294s1c1
Sequence:CCGGGAGCAGATCAAGAACGGGATTCTCGAGAATCCCGTTCTTGATCTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144613.3-149s1c1
Sequence:CCGGGATCCGTAACTGCTACCAGAACTCGAGTTCTGGTAGCAGTTACGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144613.4-543s21c1
Sequence:CCGGAGTGTCTAAGCCACGAATAATCTCGAGATTATTCGTGGCTTAGACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144613.4-340s21c1
Sequence:CCGGACGCAGCCCTGCGAGTACTATCTCGAGATAGTACTCGCAGGGCTGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144613
COX6B2 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIb polypeptide 2 (testis)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144613.3-233s1c1
Sequence:CCGGCGAGTACTATTTCCGCGTGTACTCGAGTACACGCGGAAATAGTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144613.3-136s1c1
Sequence:CCGGCCAGCCAGAACCAGATCCGTACTCGAGTACGGATCTGGTTCTGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144613.3-161s1c1
Sequence:CCGGCTACCAGAACTTCCTGGACTACTCGAGTAGTCCAGGAAGTTCTGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144613.3-294s1c1
Sequence:CCGGGAGCAGATCAAGAACGGGATTCTCGAGAATCCCGTTCTTGATCTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144613.3-149s1c1
Sequence:CCGGGATCCGTAACTGCTACCAGAACTCGAGTTCTGGTAGCAGTTACGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144613.4-543s21c1
Sequence:CCGGAGTGTCTAAGCCACGAATAATCTCGAGATTATTCGTGGCTTAGACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144613.4-340s21c1
Sequence:CCGGACGCAGCCCTGCGAGTACTATCTCGAGATAGTACTCGCAGGGCTGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183405
COX6B2 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIb polypeptide 2 (testis)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183405.1-243s1c1
Sequence:CCGGGCGTAACTGCTACCAGAATTTCTCGAGAAATTCTGGTAGCAGTTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183405.1-324s1c1
Sequence:CCGGCGAGTACTATTTCCGTGTATTCTCGAGAATACACGGAAATAGTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183405.1-387s1c1
Sequence:CCGGGCAGATCAAGCAGGGAACTTTCTCGAGAAAGTTCCCTGCTTGATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183405.1-277s1c1
Sequence:CCGGCGGTGTGTGAAGACCATGAATCTCGAGATTCATGGTCTTCACACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183405.1-322s1c1
Sequence:CCGGTGCGAGTACTATTTCCGTGTACTCGAGTACACGGAAATAGTACTCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183405
COX6B2 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIb polypeptide 2 (testis)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183405.1-243s1c1
Sequence:CCGGGCGTAACTGCTACCAGAATTTCTCGAGAAATTCTGGTAGCAGTTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183405.1-324s1c1
Sequence:CCGGCGAGTACTATTTCCGTGTATTCTCGAGAATACACGGAAATAGTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183405.1-387s1c1
Sequence:CCGGGCAGATCAAGCAGGGAACTTTCTCGAGAAAGTTCCCTGCTTGATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183405.1-277s1c1
Sequence:CCGGCGGTGTGTGAAGACCATGAATCTCGAGATTCATGGTCTTCACACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183405.1-322s1c1
Sequence:CCGGTGCGAGTACTATTTCCGTGTACTCGAGTACACGGAAATAGTACTCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183405
COX6B2 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIb polypeptide 2 (testis)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183405.1-243s1c1
Sequence:CCGGGCGTAACTGCTACCAGAATTTCTCGAGAAATTCTGGTAGCAGTTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183405.1-324s1c1
Sequence:CCGGCGAGTACTATTTCCGTGTATTCTCGAGAATACACGGAAATAGTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183405.1-387s1c1
Sequence:CCGGGCAGATCAAGCAGGGAACTTTCTCGAGAAAGTTCCCTGCTTGATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183405.1-277s1c1
Sequence:CCGGCGGTGTGTGAAGACCATGAATCTCGAGATTCATGGTCTTCACACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183405.1-322s1c1
Sequence:CCGGTGCGAGTACTATTTCCGTGTACTCGAGTACACGGAAATAGTACTCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)