EMAIL THIS PAGE TO A FRIEND

COX7A2L

cytochrome c oxidase subunit VIIa polypeptide 2 like

91 Gene Product Result for
Synonyms: COX7AR COX7RP EB1 SIG81
UniProtKB ID: O14548, Q9P118
Gene ID:
Human(9167) Summary: Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein similar to polypeptides 1 and 2 of subunit VIIa in the C-terminal region, and also highly similar to the mouse Sig81 protein sequence. This gene is expressed in all tissues, and upregulated in a breast cancer cell line after estrogen treatment. It is possible that this gene represents a regulatory subunit of COX and mediates the higher level of energy production in target cells by estrogen. [provided by RefSeq, Jul 2008]
Mouse(20463) cytochrome c oxidase subunit VIIa polypeptide 2-like
Rat(298762) cytochrome c oxidase subunit VIIa polypeptide 2 like
chicken(421392) cytochrome c oxidase subunit VIIa polypeptide 2 like
cow(540225) cytochrome c oxidase subunit VIIa polypeptide 2 like
dog(475739) cytochrome c oxidase subunit VIIa polypeptide 2 like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004718 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004718 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004718 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009187 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009187 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009187 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU092741 MISSION® esiRNA esiRNA targeting mouse Cox7a2l (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004718 Rosetta Predictions human pricing
NM_001106704 Rosetta Predictions rat pricing
NM_009187 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338184 predicted 733
2 SASI_Hs01_00081409 predicted 689
3 SASI_Hs02_00338185 predicted 199
4 SASI_Hs01_00081411 predicted 196
5 SASI_Hs01_00081412 predicted 703
6 SASI_Hs01_00081413 predicted 223
7 SASI_Hs01_00081414 predicted 784
8 SASI_Hs02_00338186 predicted 798
9 SASI_Hs01_00081416 predicted 888
10 SASI_Hs01_00081417 predicted 787
11 SASI_Hs01_00081410 predicted 748
12 SASI_Hs01_00081415 predicted 738
13 SASI_Hs01_00081418 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106704 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221568 predicted 610
2 SASI_Rn02_00221569 predicted 757
3 SASI_Rn02_00221570 predicted 754
4 SASI_Rn02_00221571 predicted 401
5 SASI_Rn02_00221572 predicted 974
6 SASI_Rn02_00221573 predicted 544
7 SASI_Rn02_00221574 predicted 717
8 SASI_Rn02_00221575 predicted 329
9 SASI_Rn02_00221576 predicted 866
10 SASI_Rn02_00221577 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009187 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152789 predicted 222
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004718
VALIDATED
COX7A2L MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIIa polypeptide 2 like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004718.2-179s1c1
Sequence:CCGGCCAACTAAACTGACCTCCGATCTCGAGATCGGAGGTCAGTTTAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004718.2-206s1c1
Sequence:CCGGGTGTATGATTATGCTGGGAAACTCGAGTTTCCCAGCATAATCATACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004718.2-295s1c1
Sequence:CCGGCCTGCCTGACCAAATGCTTTACTCGAGTAAAGCATTTGGTCAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004718.2-195s1c1
Sequence:CCGGCCGATTCCACAGTGTATGATTCTCGAGAATCATACACTGTGGAATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004718.2-126s1c1
Sequence:CCGGAGGGATTAAAGCCTGTGGTTTCTCGAGAAACCACAGGCTTTAATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004718.2-100s21c1
Sequence:CCGGATGGGCTTCGGAGGCCTATAGCTCGAGCTATAGGCCTCCGAAGCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004718.2-295s21c1
Sequence:CCGGCCTGCCTGACCAAATGCTTTACTCGAGTAAAGCATTTGGTCAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004718.2-195s21c1
Sequence:CCGGCCGATTCCACAGTGTATGATTCTCGAGAATCATACACTGTGGAATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004718.2-126s21c1
Sequence:CCGGAGGGATTAAAGCCTGTGGTTTCTCGAGAAACCACAGGCTTTAATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004718.2-896s21c1
Sequence:CCGGGGTAATTTCAAAGGGTTATTTCTCGAGAAATAACCCTTTGAAATTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004718
VALIDATED
COX7A2L MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIIa polypeptide 2 like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004718.2-179s1c1
Sequence:CCGGCCAACTAAACTGACCTCCGATCTCGAGATCGGAGGTCAGTTTAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004718.2-206s1c1
Sequence:CCGGGTGTATGATTATGCTGGGAAACTCGAGTTTCCCAGCATAATCATACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004718.2-295s1c1
Sequence:CCGGCCTGCCTGACCAAATGCTTTACTCGAGTAAAGCATTTGGTCAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004718.2-195s1c1
Sequence:CCGGCCGATTCCACAGTGTATGATTCTCGAGAATCATACACTGTGGAATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004718.2-126s1c1
Sequence:CCGGAGGGATTAAAGCCTGTGGTTTCTCGAGAAACCACAGGCTTTAATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004718.2-100s21c1
Sequence:CCGGATGGGCTTCGGAGGCCTATAGCTCGAGCTATAGGCCTCCGAAGCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004718.2-295s21c1
Sequence:CCGGCCTGCCTGACCAAATGCTTTACTCGAGTAAAGCATTTGGTCAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004718.2-195s21c1
Sequence:CCGGCCGATTCCACAGTGTATGATTCTCGAGAATCATACACTGTGGAATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004718.2-126s21c1
Sequence:CCGGAGGGATTAAAGCCTGTGGTTTCTCGAGAAACCACAGGCTTTAATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004718.2-896s21c1
Sequence:CCGGGGTAATTTCAAAGGGTTATTTCTCGAGAAATAACCCTTTGAAATTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004718
VALIDATED
COX7A2L MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIIa polypeptide 2 like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004718.2-179s1c1
Sequence:CCGGCCAACTAAACTGACCTCCGATCTCGAGATCGGAGGTCAGTTTAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004718.2-206s1c1
Sequence:CCGGGTGTATGATTATGCTGGGAAACTCGAGTTTCCCAGCATAATCATACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004718.2-295s1c1
Sequence:CCGGCCTGCCTGACCAAATGCTTTACTCGAGTAAAGCATTTGGTCAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004718.2-195s1c1
Sequence:CCGGCCGATTCCACAGTGTATGATTCTCGAGAATCATACACTGTGGAATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004718.2-126s1c1
Sequence:CCGGAGGGATTAAAGCCTGTGGTTTCTCGAGAAACCACAGGCTTTAATCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004718.2-100s21c1
Sequence:CCGGATGGGCTTCGGAGGCCTATAGCTCGAGCTATAGGCCTCCGAAGCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004718.2-295s21c1
Sequence:CCGGCCTGCCTGACCAAATGCTTTACTCGAGTAAAGCATTTGGTCAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004718.2-195s21c1
Sequence:CCGGCCGATTCCACAGTGTATGATTCTCGAGAATCATACACTGTGGAATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004718.2-126s21c1
Sequence:CCGGAGGGATTAAAGCCTGTGGTTTCTCGAGAAACCACAGGCTTTAATCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004718.2-896s21c1
Sequence:CCGGGGTAATTTCAAAGGGTTATTTCTCGAGAAATAACCCTTTGAAATTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009187
VALIDATED
COX7A2L MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIIa polypeptide 2 like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009187.1-429s1c1
Sequence:CCGGCCACTTGGATAGTCTACTTAACTCGAGTTAAGTAGACTATCCAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009187.1-231s1c1
Sequence:CCGGGCTGATGGTTTCCACCTGAAACTCGAGTTTCAGGTGGAAACCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009187.1-118s1c1
Sequence:CCGGCAGAAGCACCACCTATCATATCTCGAGATATGATAGGTGGTGCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009187.1-166s1c1
Sequence:CCGGGTGTGACAGCATATGATTATTCTCGAGAATAATCATATGCTGTCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009187.1-130s1c1
Sequence:CCGGCTATCATATTTGCCACACCAACTCGAGTTGGTGTGGCAAATATGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009187.3-372s21c1
Sequence:CCGGCCTCGCAGCCCAGAAACAAATCTCGAGATTTGTTTCTGGGCTGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009187.3-198s21c1
Sequence:CCGGGTGTGACAGCATATGATTATTCTCGAGAATAATCATATGCTGTCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009187.3-461s21c1
Sequence:CCGGCCACTTGGATAGTCTACTTAACTCGAGTTAAGTAGACTATCCAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009187.3-289s21c1
Sequence:CCGGCCTTCCAGACCAAATGCTTTACTCGAGTAAAGCATTTGGTCTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009187.3-262s21c1
Sequence:CCGGGGCTGATGGTTTCCACCTGAACTCGAGTTCAGGTGGAAACCATCAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009187
VALIDATED
COX7A2L MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIIa polypeptide 2 like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009187.1-429s1c1
Sequence:CCGGCCACTTGGATAGTCTACTTAACTCGAGTTAAGTAGACTATCCAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009187.1-231s1c1
Sequence:CCGGGCTGATGGTTTCCACCTGAAACTCGAGTTTCAGGTGGAAACCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009187.1-118s1c1
Sequence:CCGGCAGAAGCACCACCTATCATATCTCGAGATATGATAGGTGGTGCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009187.1-166s1c1
Sequence:CCGGGTGTGACAGCATATGATTATTCTCGAGAATAATCATATGCTGTCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009187.1-130s1c1
Sequence:CCGGCTATCATATTTGCCACACCAACTCGAGTTGGTGTGGCAAATATGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009187.3-372s21c1
Sequence:CCGGCCTCGCAGCCCAGAAACAAATCTCGAGATTTGTTTCTGGGCTGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009187.3-198s21c1
Sequence:CCGGGTGTGACAGCATATGATTATTCTCGAGAATAATCATATGCTGTCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009187.3-461s21c1
Sequence:CCGGCCACTTGGATAGTCTACTTAACTCGAGTTAAGTAGACTATCCAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009187.3-289s21c1
Sequence:CCGGCCTTCCAGACCAAATGCTTTACTCGAGTAAAGCATTTGGTCTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009187.3-262s21c1
Sequence:CCGGGGCTGATGGTTTCCACCTGAACTCGAGTTCAGGTGGAAACCATCAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009187
VALIDATED
COX7A2L MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIIa polypeptide 2 like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009187.1-429s1c1
Sequence:CCGGCCACTTGGATAGTCTACTTAACTCGAGTTAAGTAGACTATCCAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009187.1-231s1c1
Sequence:CCGGGCTGATGGTTTCCACCTGAAACTCGAGTTTCAGGTGGAAACCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009187.1-118s1c1
Sequence:CCGGCAGAAGCACCACCTATCATATCTCGAGATATGATAGGTGGTGCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009187.1-166s1c1
Sequence:CCGGGTGTGACAGCATATGATTATTCTCGAGAATAATCATATGCTGTCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009187.1-130s1c1
Sequence:CCGGCTATCATATTTGCCACACCAACTCGAGTTGGTGTGGCAAATATGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009187.3-372s21c1
Sequence:CCGGCCTCGCAGCCCAGAAACAAATCTCGAGATTTGTTTCTGGGCTGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009187.3-198s21c1
Sequence:CCGGGTGTGACAGCATATGATTATTCTCGAGAATAATCATATGCTGTCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009187.3-461s21c1
Sequence:CCGGCCACTTGGATAGTCTACTTAACTCGAGTTAAGTAGACTATCCAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009187.3-289s21c1
Sequence:CCGGCCTTCCAGACCAAATGCTTTACTCGAGTAAAGCATTTGGTCTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009187.3-262s21c1
Sequence:CCGGGGCTGATGGTTTCCACCTGAACTCGAGTTCAGGTGGAAACCATCAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)