EMAIL THIS PAGE TO A FRIEND

COX7A2P2

cytochrome c oxidase subunit VIIa polypeptide 2 (liver) pseudogene 2

Gene Product Result for
Synonyms: COX7A3 COX7AL COX7AL2 COX7AP2
Species: Human COX7A2P2(1348)
UniProtKB ID: O60397
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183003
COX7A2P2 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIIa polypeptide 2 (liver) pseudogene 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183003.1-127s1c1
Sequence:CCGGCTGTATCTAAAGGGTGGGATACTCGAGTATCCCACCCTTTAGATACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183003.1-144s1c1
Sequence:CCGGGATAGCTGATGCCCTCCTTCACTCGAGTGAAGGAGGGCATCAGCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183003.1-38s1c1
Sequence:CCGGAGAGGACCATAAGCACTGCTTCTCGAGAAGCAGTGCTTATGGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183003.1-160s1c1
Sequence:CCGGCTTCATAGAGCCACCATGATTCTCGAGAATCATGGTGGCTCTATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183003.1-169s1c1
Sequence:CCGGGCCACCATGATTCTTACAGTTCTCGAGAACTGTAAGAATCATGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183003
COX7A2P2 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIIa polypeptide 2 (liver) pseudogene 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183003.1-127s1c1
Sequence:CCGGCTGTATCTAAAGGGTGGGATACTCGAGTATCCCACCCTTTAGATACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183003.1-144s1c1
Sequence:CCGGGATAGCTGATGCCCTCCTTCACTCGAGTGAAGGAGGGCATCAGCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183003.1-38s1c1
Sequence:CCGGAGAGGACCATAAGCACTGCTTCTCGAGAAGCAGTGCTTATGGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183003.1-160s1c1
Sequence:CCGGCTTCATAGAGCCACCATGATTCTCGAGAATCATGGTGGCTCTATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183003.1-169s1c1
Sequence:CCGGGCCACCATGATTCTTACAGTTCTCGAGAACTGTAAGAATCATGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183003
COX7A2P2 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIIa polypeptide 2 (liver) pseudogene 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183003.1-127s1c1
Sequence:CCGGCTGTATCTAAAGGGTGGGATACTCGAGTATCCCACCCTTTAGATACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183003.1-144s1c1
Sequence:CCGGGATAGCTGATGCCCTCCTTCACTCGAGTGAAGGAGGGCATCAGCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183003.1-38s1c1
Sequence:CCGGAGAGGACCATAAGCACTGCTTCTCGAGAAGCAGTGCTTATGGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183003.1-160s1c1
Sequence:CCGGCTTCATAGAGCCACCATGATTCTCGAGAATCATGGTGGCTCTATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183003.1-169s1c1
Sequence:CCGGGCCACCATGATTCTTACAGTTCTCGAGAACTGTAAGAATCATGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)