EMAIL THIS PAGE TO A FRIEND

CP

ceruloplasmin (ferroxidase)

62 Gene Product Result for
Synonyms: CP-2
UniProtKB ID: P00450, Q14063, Q2PP18, Q9UKS4
Gene ID:
Human(1356) Summary: The protein encoded by this gene is a metalloprotein that binds most of the copper in plasma and is involved in the peroxidation of Fe(II)transferrin to Fe(III) transferrin. Mutations in this gene cause aceruloplasminemia, which results in iron accumulation and tissue damage, and is associated with diabetes and neurologic abnormalities. Two transcript variants, one protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Feb 2012]
Mouse(12870) ceruloplasmin
Rat(24268) ceruloplasmin (ferroxidase)
Zebrafish(84702) ceruloplasmin
chicken(771940) ceruloplasmin (ferroxidase)
cow(526230) ceruloplasmin (ferroxidase)
Horse(100058573) ceruloplasmin (ferroxidase)
domestic cat(101081158) ceruloplasmin (ferroxidase)
dog(442963) ceruloplasmin (ferroxidase)
domestic guinea pig(100717028) ceruloplasmin (ferroxidase)
naked mole-rat(101717103) ceruloplasmin (ferroxidase)
sheep(443053) ceruloplasmin (ferroxidase)
Domestic Rabbit(100340335) ceruloplasmin (ferroxidase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK177 Ceruloplasmin Activity Colorimetric Kit Sufficient for 100 Colorimetric tests human, mouse, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0496 AQUA Peptide YAPSGIDIFT[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007752 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007752 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007752 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000096 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000096 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000096 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000096 Rosetta Predictions human pricing
NM_012532 Rosetta Predictions rat pricing
NM_001042611 Rosetta Predictions mouse pricing
NM_007752 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000096 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108243 predicted 1407 154.00
2 SASI_Hs02_00301862 predicted 933 154.00
3 SASI_Hs01_00108244 predicted 1490 154.00
4 SASI_Hs02_00301863 predicted 340 154.00
5 SASI_Hs01_00108248 predicted 1163 154.00
6 SASI_Hs01_00108249 predicted 2193 154.00
7 SASI_Hs01_00108250 predicted 1634 154.00
8 SASI_Hs02_00301864 predicted 433 154.00
9 SASI_Hs01_00108251 predicted 1400 154.00
10 SASI_Hs01_00108252 predicted 3177 154.00
11 SASI_Hs01_00108245 predicted 1886 154.00
12 SASI_Hs01_00108246 predicted 1868 154.00
13 SASI_Hs01_00108247 predicted 2530 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012532 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115103 predicted 1115 154.00
2 SASI_Rn01_00115104 predicted 2598 154.00
3 SASI_Rn01_00115105 predicted 2672 154.00
4 SASI_Rn01_00115106 predicted 1681 154.00
5 SASI_Rn02_00259609 predicted 572 154.00
6 SASI_Rn01_00115108 predicted 2513 154.00
7 SASI_Rn01_00115109 predicted 1598 154.00
8 SASI_Rn01_00115110 predicted 1523 154.00
9 SASI_Rn01_00115111 predicted 2558 154.00
10 SASI_Rn01_00115112 predicted 1852 154.00
11 SASI_Rn01_00115107 predicted 774 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042611 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290715 predicted 1424 154.00
2 SASI_Mm02_00290716 predicted 1461 154.00
3 SASI_Mm02_00290717 predicted 2753 154.00
4 SASI_Mm02_00290718 predicted 2887 154.00
5 SASI_Mm02_00290719 predicted 2013 154.00
6 SASI_Mm02_00290720 predicted 780 154.00
7 SASI_Mm02_00290721 predicted 2738 154.00
8 SASI_Mm02_00290722 predicted 1642 154.00
9 SASI_Mm02_00290723 predicted 3140 154.00
10 SASI_Mm02_00290724 predicted 2404 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007752 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312366 predicted 1430 154.00
2 SASI_Mm01_00191913 predicted 1461 154.00
3 SASI_Mm02_00312367 predicted 2753 154.00
4 SASI_Mm01_00191915 predicted 2883 154.00
5 SASI_Mm02_00312368 predicted 2006 154.00
6 SASI_Mm01_00191918 predicted 787 154.00
7 SASI_Mm01_00191919 predicted 2734 154.00
8 SASI_Mm02_00312369 predicted 1647 154.00
9 SASI_Mm02_00312370 predicted 3144 154.00
10 SASI_Mm02_00312371 predicted 2405 154.00
11 SASI_Mm01_00191912 predicted 293 154.00
12 SASI_Mm01_00191914 predicted 2638 154.00
13 SASI_Mm01_00191916 predicted 1021 154.00
14 SASI_Mm01_00191917 predicted 2286 154.00
15 SASI_Mm01_00191920 predicted 3024 154.00
16 SASI_Mm01_00191921 predicted 1935 154.00
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007752
VALIDATED
CP MISSION shRNA Bacterial Glycerol Stock
ceruloplasmin (ferroxidase)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007752.1-3150s1c1
Sequence:CCGGCCCTGGAACATACCAAACCTTCTCGAGAAGGTTTGGTATGTTCCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007752.1-556s1c1
Sequence:CCGGCCCGGACAACAGTATGTGTATCTCGAGATACACATACTGTTGTCCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007752.2-681s21c1
Sequence:CCGGCCCGGACAACAGTATGTGTATCTCGAGATACACATACTGTTGTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007752.1-155s1c1
Sequence:CCGGCCTTGGCAAGAGATAAGCATTCTCGAGAATGCTTATCTCTTGCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007752.2-280s21c1
Sequence:CCGGCCTTGGCAAGAGATAAGCATTCTCGAGAATGCTTATCTCTTGCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007752.2-3593s21c1
Sequence:CCGGACTTGACACAGCCCACTTATCCTCGAGGATAAGTGGGCTGTGTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007752.1-2445s1c1
Sequence:CCGGCCAGTTTACTGACAGCTCATTCTCGAGAATGAGCTGTCAGTAAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007752.2-2570s21c1
Sequence:CCGGCCAGTTTACTGACAGCTCATTCTCGAGAATGAGCTGTCAGTAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007752
VALIDATED
CP MISSION shRNA shRNA Plasmid DNA
ceruloplasmin (ferroxidase)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007752.1-3150s1c1
Sequence:CCGGCCCTGGAACATACCAAACCTTCTCGAGAAGGTTTGGTATGTTCCAGGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000201883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007752.1-556s1c1
Sequence:CCGGCCCGGACAACAGTATGTGTATCTCGAGATACACATACTGTTGTCCGGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000340225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007752.2-681s21c1
Sequence:CCGGCCCGGACAACAGTATGTGTATCTCGAGATACACATACTGTTGTCCGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000192062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007752.1-155s1c1
Sequence:CCGGCCTTGGCAAGAGATAAGCATTCTCGAGAATGCTTATCTCTTGCCAAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000340283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007752.2-280s21c1
Sequence:CCGGCCTTGGCAAGAGATAAGCATTCTCGAGAATGCTTATCTCTTGCCAAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000340285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007752.2-3593s21c1
Sequence:CCGGACTTGACACAGCCCACTTATCCTCGAGGATAAGTGGGCTGTGTCAAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000192246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007752.1-2445s1c1
Sequence:CCGGCCAGTTTACTGACAGCTCATTCTCGAGAATGAGCTGTCAGTAAACTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000340226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007752.2-2570s21c1
Sequence:CCGGCCAGTTTACTGACAGCTCATTCTCGAGAATGAGCTGTCAGTAAACTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007752
VALIDATED
CP MISSION shRNA Lentiviral Transduction Particles
ceruloplasmin (ferroxidase)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007752.1-3150s1c1
Sequence:CCGGCCCTGGAACATACCAAACCTTCTCGAGAAGGTTTGGTATGTTCCAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007752.1-556s1c1
Sequence:CCGGCCCGGACAACAGTATGTGTATCTCGAGATACACATACTGTTGTCCGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007752.2-681s21c1
Sequence:CCGGCCCGGACAACAGTATGTGTATCTCGAGATACACATACTGTTGTCCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007752.1-155s1c1
Sequence:CCGGCCTTGGCAAGAGATAAGCATTCTCGAGAATGCTTATCTCTTGCCAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007752.2-280s21c1
Sequence:CCGGCCTTGGCAAGAGATAAGCATTCTCGAGAATGCTTATCTCTTGCCAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007752.2-3593s21c1
Sequence:CCGGACTTGACACAGCCCACTTATCCTCGAGGATAAGTGGGCTGTGTCAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007752.1-2445s1c1
Sequence:CCGGCCAGTTTACTGACAGCTCATTCTCGAGAATGAGCTGTCAGTAAACTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007752.2-2570s21c1
Sequence:CCGGCCAGTTTACTGACAGCTCATTCTCGAGAATGAGCTGTCAGTAAACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000096
VALIDATED
CP MISSION shRNA Bacterial Glycerol Stock
ceruloplasmin (ferroxidase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000096.1-2824s1c1
Sequence:CCGGCCCGAGAAAGTAAACAAAGATCTCGAGATCTTTGTTTACTTTCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000096.1-1744s1c1
Sequence:CCGGCCTACAGTATTTGATGAGAATCTCGAGATTCTCATCAAATACTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000096.1-1565s1c1
Sequence:CCGGCCAAAGAAGTAGGACCCACTACTCGAGTAGTGGGTCCTACTTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000096.1-3058s1c1
Sequence:CCGGCCTGGAACATACCAAACCCTACTCGAGTAGGGTTTGGTATGTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_000096.1-178s1c1
Sequence:CCGGCCAGATAGAATTGGGAGACTACTCGAGTAGTCTCCCAATTCTATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000096.3-1997s21c1
Sequence:CCGGCCTACAGTATTTGATGAGAATCTCGAGATTCTCATCAAATACTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000096.3-2172s21c1
Sequence:CCGGATTCGGTCGTGTGGTACTTATCTCGAGATAAGTACCACACGACCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000096.3-1708s21c1
Sequence:CCGGCAACGAGGGCACATACTATTCCTCGAGGAATAGTATGTGCCCTCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000096.3-2210s21c1
Sequence:CCGGGCCGATGTACATGGAATATACCTCGAGGTATATTCCATGTACATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000096.3-431s21c1
Sequence:CCGGCCAGATAGAATTGGGAGACTACTCGAGTAGTCTCCCAATTCTATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000096
VALIDATED
CP MISSION shRNA shRNA Plasmid DNA
ceruloplasmin (ferroxidase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000096.1-2824s1c1
Sequence:CCGGCCCGAGAAAGTAAACAAAGATCTCGAGATCTTTGTTTACTTTCTCGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000046055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000096.1-1744s1c1
Sequence:CCGGCCTACAGTATTTGATGAGAATCTCGAGATTCTCATCAAATACTGTAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000046056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000096.1-1565s1c1
Sequence:CCGGCCAAAGAAGTAGGACCCACTACTCGAGTAGTGGGTCCTACTTCTTTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000046057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000096.1-3058s1c1
Sequence:CCGGCCTGGAACATACCAAACCCTACTCGAGTAGGGTTTGGTATGTTCCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000046054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_000096.1-178s1c1
Sequence:CCGGCCAGATAGAATTGGGAGACTACTCGAGTAGTCTCCCAATTCTATCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000315704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000096.3-1997s21c1
Sequence:CCGGCCTACAGTATTTGATGAGAATCTCGAGATTCTCATCAAATACTGTAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000303484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000096.3-2172s21c1
Sequence:CCGGATTCGGTCGTGTGGTACTTATCTCGAGATAAGTACCACACGACCGAATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000303485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000096.3-1708s21c1
Sequence:CCGGCAACGAGGGCACATACTATTCCTCGAGGAATAGTATGTGCCCTCGTTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000303556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000096.3-2210s21c1
Sequence:CCGGGCCGATGTACATGGAATATACCTCGAGGTATATTCCATGTACATCGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000315640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000096.3-431s21c1
Sequence:CCGGCCAGATAGAATTGGGAGACTACTCGAGTAGTCTCCCAATTCTATCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000096
VALIDATED
CP MISSION shRNA Lentiviral Transduction Particles
ceruloplasmin (ferroxidase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000096.1-2824s1c1
Sequence:CCGGCCCGAGAAAGTAAACAAAGATCTCGAGATCTTTGTTTACTTTCTCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000096.1-1744s1c1
Sequence:CCGGCCTACAGTATTTGATGAGAATCTCGAGATTCTCATCAAATACTGTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000096.1-1565s1c1
Sequence:CCGGCCAAAGAAGTAGGACCCACTACTCGAGTAGTGGGTCCTACTTCTTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000096.1-3058s1c1
Sequence:CCGGCCTGGAACATACCAAACCCTACTCGAGTAGGGTTTGGTATGTTCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_000096.1-178s1c1
Sequence:CCGGCCAGATAGAATTGGGAGACTACTCGAGTAGTCTCCCAATTCTATCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000096.3-1997s21c1
Sequence:CCGGCCTACAGTATTTGATGAGAATCTCGAGATTCTCATCAAATACTGTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000096.3-2172s21c1
Sequence:CCGGATTCGGTCGTGTGGTACTTATCTCGAGATAAGTACCACACGACCGAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000096.3-1708s21c1
Sequence:CCGGCAACGAGGGCACATACTATTCCTCGAGGAATAGTATGTGCCCTCGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000096.3-2210s21c1
Sequence:CCGGGCCGATGTACATGGAATATACCTCGAGGTATATTCCATGTACATCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000096.3-431s21c1
Sequence:CCGGCCAGATAGAATTGGGAGACTACTCGAGTAGTCTCCCAATTCTATCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)