EMAIL THIS PAGE TO A FRIEND

CPN1

carboxypeptidase N, polypeptide 1

57 Gene Product Result for
Synonyms: CPN SCPN
UniProtKB ID: P15169
Gene ID:
Human(1369) Summary: Carboxypeptidase N is a plasma metallo-protease that cleaves basic amino acids from the C terminal of peptides and proteins. The enzyme is important in the regulation of peptides like kinins and anaphylatoxins, and has also been known as kininase-1 and anaphylatoxin inactivator. This enzyme is a tetramer comprised of two identical regulatory subunits and two identical catalytic subunits; this gene encodes the catalytic subunit. Mutations in this gene can be associated with angioedema or chronic urticaria resulting from carboxypeptidase N deficiency. [provided by RefSeq, Jul 2008]
Mouse(93721) carboxypeptidase N, polypeptide 1
Rat(365466) carboxypeptidase N, polypeptide 1
Zebrafish(337172) carboxypeptidase N, polypeptide 1
dog(477795) carboxypeptidase N, polypeptide 1
domestic cat(101090390) carboxypeptidase N, polypeptide 1
cow(536753) carboxypeptidase N, polypeptide 1
Horse(100070412) carboxypeptidase N, polypeptide 1
chicken(769143) carboxypeptidase N, polypeptide 1
naked mole-rat(101718051) carboxypeptidase N, polypeptide 1
domestic guinea pig(100725809) carboxypeptidase N, polypeptide 1
sheep(101120287) carboxypeptidase N, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
B8011 DL-Benzylsuccinic acid ≥99% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001308 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001308 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001308 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030703 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030703 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030703 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001308 Rosetta Predictions human pricing
NM_053526 Rosetta Predictions rat pricing
NM_030703 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001308 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153416 predicted 1058
2 SASI_Hs01_00153417 predicted 1133
3 SASI_Hs02_00331592 predicted 741
4 SASI_Hs01_00153419 predicted 1339
5 SASI_Hs01_00153420 predicted 706
6 SASI_Hs02_00331593 predicted 1482
7 SASI_Hs01_00153421 predicted 1372
8 SASI_Hs01_00153423 predicted 748
9 SASI_Hs02_00331594 predicted 1354
10 SASI_Hs01_00153424 predicted 1047
11 SASI_Hs01_00153415 predicted 655
12 SASI_Hs01_00153418 predicted 873
13 SASI_Hs01_00153422 predicted 1121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266141 predicted 875
2 SASI_Rn02_00266142 predicted 1155
3 SASI_Rn01_00042494 predicted 384
4 SASI_Rn01_00042492 predicted 490
5 SASI_Rn02_00266143 predicted 790
6 SASI_Rn01_00042496 predicted 675
7 SASI_Rn02_00266144 predicted 1407
8 SASI_Rn01_00042498 predicted 682
9 SASI_Rn01_00042499 predicted 850
10 SASI_Rn02_00266145 predicted 309
11 SASI_Rn01_00042493 predicted 637
12 SASI_Rn01_00042495 predicted 332
13 SASI_Rn01_00042497 predicted 1241
14 SASI_Rn01_00042500 predicted 1021
15 SASI_Rn01_00042501 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074410 predicted 660
2 SASI_Mm01_00074411 predicted 529
3 SASI_Mm01_00074412 predicted 909
4 SASI_Mm01_00074413 predicted 1559
5 SASI_Mm01_00074415 predicted 1106
6 SASI_Mm01_00074417 predicted 1252
7 SASI_Mm01_00074418 predicted 706
8 SASI_Mm01_00074419 predicted 891
9 SASI_Mm02_00336874 predicted 903
10 SASI_Mm02_00336875 predicted 852
11 SASI_Mm01_00074414 predicted 1130
12 SASI_Mm01_00074416 predicted 966
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001308
CPN1 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase N, polypeptide 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001308.2-484s21c1
Sequence:CCGGTGGAACCAGAGGTCAAGTATGCTCGAGCATACTTGACCTCTGGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001308.2-1318s21c1
Sequence:CCGGATCTCGCCAATGCTGTCATTTCTCGAGAAATGACAGCATTGGCGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001308.1-1357s1c1
Sequence:CCGGCCAGGTATCTACACTGTTAGTCTCGAGACTAACAGTGTAGATACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001308.1-293s1c1
Sequence:CCGGGCTATGATGATCTTGTGCGGACTCGAGTCCGCACAAGATCATCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001308.1-1440s1c1
Sequence:CCGGGTTGGTTAACTTCCACCTCAACTCGAGTTGAGGTGGAAGTTAACCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001308.1-1249s1c1
Sequence:CCGGGTGCTTGATGAGAATTACAATCTCGAGATTGTAATTCTCATCAAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001308.1-702s1c1
Sequence:CCGGCCCTGATCTCAATACCTATATCTCGAGATATAGGTATTGAGATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001308
CPN1 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase N, polypeptide 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001308.2-484s21c1
Sequence:CCGGTGGAACCAGAGGTCAAGTATGCTCGAGCATACTTGACCTCTGGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001308.2-1318s21c1
Sequence:CCGGATCTCGCCAATGCTGTCATTTCTCGAGAAATGACAGCATTGGCGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001308.1-1357s1c1
Sequence:CCGGCCAGGTATCTACACTGTTAGTCTCGAGACTAACAGTGTAGATACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001308.1-293s1c1
Sequence:CCGGGCTATGATGATCTTGTGCGGACTCGAGTCCGCACAAGATCATCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001308.1-1440s1c1
Sequence:CCGGGTTGGTTAACTTCCACCTCAACTCGAGTTGAGGTGGAAGTTAACCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001308.1-1249s1c1
Sequence:CCGGGTGCTTGATGAGAATTACAATCTCGAGATTGTAATTCTCATCAAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001308.1-702s1c1
Sequence:CCGGCCCTGATCTCAATACCTATATCTCGAGATATAGGTATTGAGATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001308
CPN1 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase N, polypeptide 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001308.2-484s21c1
Sequence:CCGGTGGAACCAGAGGTCAAGTATGCTCGAGCATACTTGACCTCTGGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001308.2-1318s21c1
Sequence:CCGGATCTCGCCAATGCTGTCATTTCTCGAGAAATGACAGCATTGGCGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001308.1-1357s1c1
Sequence:CCGGCCAGGTATCTACACTGTTAGTCTCGAGACTAACAGTGTAGATACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001308.1-293s1c1
Sequence:CCGGGCTATGATGATCTTGTGCGGACTCGAGTCCGCACAAGATCATCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001308.1-1440s1c1
Sequence:CCGGGTTGGTTAACTTCCACCTCAACTCGAGTTGAGGTGGAAGTTAACCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001308.1-1249s1c1
Sequence:CCGGGTGCTTGATGAGAATTACAATCTCGAGATTGTAATTCTCATCAAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001308.1-702s1c1
Sequence:CCGGCCCTGATCTCAATACCTATATCTCGAGATATAGGTATTGAGATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030703
VALIDATED
CPN1 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase N, polypeptide 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030703.1-1087s21c1
Sequence:CCGGGTATTCTCTCAGCAAGGGAATCTCGAGATTCCCTTGCTGAGAGAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030703.1-1454s21c1
Sequence:CCGGCCAACAGTGGTTGACTTCCAACTCGAGTTGGAAGTCAACCACTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030703.1-462s21c1
Sequence:CCGGCGGAAGTCAAGTATGTGGGAACTCGAGTTCCCACATACTTGACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030703.1-1155s21c1
Sequence:CCGGAGCTGAGTTGCGACAAGTTTCCTCGAGGAAACTTGTCGCAACTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030703.1-856s21c1
Sequence:CCGGCTTCGTTCTCTCAGCCAATATCTCGAGATATTGGCTGAGAGAACGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030703.1-462s1c1
Sequence:CCGGCGGAAGTCAAGTATGTGGGAACTCGAGTTCCCACATACTTGACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030703.1-1454s1c1
Sequence:CCGGCCAACAGTGGTTGACTTCCAACTCGAGTTGGAAGTCAACCACTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030703.1-346s1c1
Sequence:CCGGGCACAACCAATGCCCGGACATCTCGAGATGTCCGGGCATTGGTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030703.1-1087s1c1
Sequence:CCGGGTATTCTCTCAGCAAGGGAATCTCGAGATTCCCTTGCTGAGAGAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030703
VALIDATED
CPN1 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase N, polypeptide 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030703.1-1087s21c1
Sequence:CCGGGTATTCTCTCAGCAAGGGAATCTCGAGATTCCCTTGCTGAGAGAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030703.1-1454s21c1
Sequence:CCGGCCAACAGTGGTTGACTTCCAACTCGAGTTGGAAGTCAACCACTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030703.1-462s21c1
Sequence:CCGGCGGAAGTCAAGTATGTGGGAACTCGAGTTCCCACATACTTGACTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030703.1-1155s21c1
Sequence:CCGGAGCTGAGTTGCGACAAGTTTCCTCGAGGAAACTTGTCGCAACTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030703.1-856s21c1
Sequence:CCGGCTTCGTTCTCTCAGCCAATATCTCGAGATATTGGCTGAGAGAACGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030703.1-462s1c1
Sequence:CCGGCGGAAGTCAAGTATGTGGGAACTCGAGTTCCCACATACTTGACTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030703.1-1454s1c1
Sequence:CCGGCCAACAGTGGTTGACTTCCAACTCGAGTTGGAAGTCAACCACTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030703.1-346s1c1
Sequence:CCGGGCACAACCAATGCCCGGACATCTCGAGATGTCCGGGCATTGGTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030703.1-1087s1c1
Sequence:CCGGGTATTCTCTCAGCAAGGGAATCTCGAGATTCCCTTGCTGAGAGAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030703
VALIDATED
CPN1 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase N, polypeptide 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030703.1-1087s21c1
Sequence:CCGGGTATTCTCTCAGCAAGGGAATCTCGAGATTCCCTTGCTGAGAGAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030703.1-1454s21c1
Sequence:CCGGCCAACAGTGGTTGACTTCCAACTCGAGTTGGAAGTCAACCACTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030703.1-462s21c1
Sequence:CCGGCGGAAGTCAAGTATGTGGGAACTCGAGTTCCCACATACTTGACTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030703.1-1155s21c1
Sequence:CCGGAGCTGAGTTGCGACAAGTTTCCTCGAGGAAACTTGTCGCAACTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030703.1-856s21c1
Sequence:CCGGCTTCGTTCTCTCAGCCAATATCTCGAGATATTGGCTGAGAGAACGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030703.1-462s1c1
Sequence:CCGGCGGAAGTCAAGTATGTGGGAACTCGAGTTCCCACATACTTGACTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030703.1-1454s1c1
Sequence:CCGGCCAACAGTGGTTGACTTCCAACTCGAGTTGGAAGTCAACCACTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030703.1-346s1c1
Sequence:CCGGGCACAACCAATGCCCGGACATCTCGAGATGTCCGGGCATTGGTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030703.1-1087s1c1
Sequence:CCGGGTATTCTCTCAGCAAGGGAATCTCGAGATTCCCTTGCTGAGAGAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)