EMAIL THIS PAGE TO A FRIEND

CPN2

carboxypeptidase N, polypeptide 2

53 Gene Product Result for
Synonyms: ACBP
UniProtKB ID: P22792, B2RPE7, Q86SU4, Q8N5V4
Gene ID:
Mouse(71756) carboxypeptidase N, polypeptide 2
Rat(303861) carboxypeptidase N, polypeptide 2
chicken(424899) carboxypeptidase N, polypeptide 2
cow(614562) carboxypeptidase N, polypeptide 2
domestic cat(101090960) carboxypeptidase N, polypeptide 2
dog(488042) carboxypeptidase N, polypeptide 2
sheep(101106297) carboxypeptidase N, polypeptide 2
Domestic Rabbit(100008823) carboxypeptidase N, polypeptide 2
domestic guinea pig(100717963) carboxypeptidase N, polypeptide 2
naked mole-rat(101696901) carboxypeptidase N, polypeptide 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_148373 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_148373 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_148373 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080513 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080513 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080513 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080513 Rosetta Predictions human pricing
XM_925798 Rosetta Predictions human pricing
NM_001107085 Rosetta Predictions rat pricing
NM_027904 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315567 predicted 1044
2 SASI_Hs02_00315568 predicted 1722
3 SASI_Hs02_00315569 predicted 264
4 SASI_Hs02_00315570 predicted 1485
5 SASI_Hs02_00315571 predicted 2051
6 SASI_Hs02_00315572 predicted 1037
7 SASI_Hs02_00315573 predicted 1943
8 SASI_Hs02_00315574 predicted 804
9 SASI_Hs02_00315575 predicted 464
10 SASI_Hs02_00315576 predicted 1448
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_925798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255092 predicted 1042
2 SASI_Hs01_00255093 predicted 1715
3 SASI_Hs01_00255094 predicted 338
4 SASI_Hs01_00255095 predicted 601
5 SASI_Hs01_00255096 predicted 1941
6 SASI_Hs01_00255097 predicted 1959
7 SASI_Hs01_00255098 predicted 2070
8 SASI_Hs01_00255099 predicted 1825
9 SASI_Hs01_00255100 predicted 1936
10 SASI_Hs01_00255101 predicted 1390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225346 predicted 1108
2 SASI_Rn02_00225347 predicted 1760
3 SASI_Rn02_00225348 predicted 867
4 SASI_Rn02_00225349 predicted 218
5 SASI_Rn02_00225350 predicted 235
6 SASI_Rn02_00225351 predicted 1793
7 SASI_Rn02_00225352 predicted 1303
8 SASI_Rn02_00225353 predicted 1226
9 SASI_Rn02_00225354 predicted 567
10 SASI_Rn02_00225355 predicted 1500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027904 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035506 predicted 1318
2 SASI_Mm01_00035507 predicted 602
3 SASI_Mm01_00035508 predicted 519
4 SASI_Mm01_00035510 predicted 1753
5 SASI_Mm01_00035511 predicted 1017
6 SASI_Mm01_00035512 predicted 228
7 SASI_Mm01_00035513 predicted 536
8 SASI_Mm01_00035514 predicted 871
9 SASI_Mm01_00035515 predicted 545
10 SASI_Mm02_00332879 predicted 1212
11 SASI_Mm01_00035509 predicted 1094
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_148373
CPN2 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase N, polypeptide 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_148373.1-2903s1c1
Sequence:CCGGGCTCTCTTTCATCTTCCCTTTCTCGAGAAAGGGAAGATGAAAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148373.1-952s1c1
Sequence:CCGGCCTTCACCTGTCTCTTTCCTACTCGAGTAGGAAAGAGACAGGTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148373.1-1309s1c1
Sequence:CCGGCCGTCTTTACAACAACCAGATCTCGAGATCTGGTTGTTGTAAAGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148373.1-664s1c1
Sequence:CCGGGCAGATGTTGAAGCTGAGTAACTCGAGTTACTCAGCTTCAACATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148373.1-1306s1c1
Sequence:CCGGGCTCCGTCTTTACAACAACCACTCGAGTGGTTGTTGTAAAGACGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_148373
CPN2 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase N, polypeptide 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_148373.1-2903s1c1
Sequence:CCGGGCTCTCTTTCATCTTCCCTTTCTCGAGAAAGGGAAGATGAAAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148373.1-952s1c1
Sequence:CCGGCCTTCACCTGTCTCTTTCCTACTCGAGTAGGAAAGAGACAGGTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148373.1-1309s1c1
Sequence:CCGGCCGTCTTTACAACAACCAGATCTCGAGATCTGGTTGTTGTAAAGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148373.1-664s1c1
Sequence:CCGGGCAGATGTTGAAGCTGAGTAACTCGAGTTACTCAGCTTCAACATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148373.1-1306s1c1
Sequence:CCGGGCTCCGTCTTTACAACAACCACTCGAGTGGTTGTTGTAAAGACGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_148373
CPN2 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase N, polypeptide 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_148373.1-2903s1c1
Sequence:CCGGGCTCTCTTTCATCTTCCCTTTCTCGAGAAAGGGAAGATGAAAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148373.1-952s1c1
Sequence:CCGGCCTTCACCTGTCTCTTTCCTACTCGAGTAGGAAAGAGACAGGTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148373.1-1309s1c1
Sequence:CCGGCCGTCTTTACAACAACCAGATCTCGAGATCTGGTTGTTGTAAAGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148373.1-664s1c1
Sequence:CCGGGCAGATGTTGAAGCTGAGTAACTCGAGTTACTCAGCTTCAACATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_148373.1-1306s1c1
Sequence:CCGGGCTCCGTCTTTACAACAACCACTCGAGTGGTTGTTGTAAAGACGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080513
CPN2 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase N, polypeptide 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080513.1-262s21c1
Sequence:CCGGGAGACCTCGTTCACCACATTGCTCGAGCAATGTGGTGAACGAGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080513.1-966s21c1
Sequence:CCGGTGGCCTGTCTCTGACCCATAACTCGAGTTATGGGTCAGAGACAGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080513.1-2519s21c1
Sequence:CCGGGGAGAATCCACATCCTATAAACTCGAGTTTATAGGATGTGGATTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080513.1-1040s21c1
Sequence:CCGGCCCTCATGCTCTCATACAATGCTCGAGCATTGTATGAGAGCATGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080513.1-335s21c1
Sequence:CCGGACACTCAGCTCTGCCAGTTTACTCGAGTAAACTGGCAGAGCTGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080513
CPN2 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase N, polypeptide 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080513.1-262s21c1
Sequence:CCGGGAGACCTCGTTCACCACATTGCTCGAGCAATGTGGTGAACGAGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080513.1-966s21c1
Sequence:CCGGTGGCCTGTCTCTGACCCATAACTCGAGTTATGGGTCAGAGACAGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080513.1-2519s21c1
Sequence:CCGGGGAGAATCCACATCCTATAAACTCGAGTTTATAGGATGTGGATTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080513.1-1040s21c1
Sequence:CCGGCCCTCATGCTCTCATACAATGCTCGAGCATTGTATGAGAGCATGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080513.1-335s21c1
Sequence:CCGGACACTCAGCTCTGCCAGTTTACTCGAGTAAACTGGCAGAGCTGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080513
CPN2 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase N, polypeptide 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080513.1-262s21c1
Sequence:CCGGGAGACCTCGTTCACCACATTGCTCGAGCAATGTGGTGAACGAGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080513.1-966s21c1
Sequence:CCGGTGGCCTGTCTCTGACCCATAACTCGAGTTATGGGTCAGAGACAGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080513.1-2519s21c1
Sequence:CCGGGGAGAATCCACATCCTATAAACTCGAGTTTATAGGATGTGGATTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080513.1-1040s21c1
Sequence:CCGGCCCTCATGCTCTCATACAATGCTCGAGCATTGTATGAGAGCATGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080513.1-335s21c1
Sequence:CCGGACACTCAGCTCTGCCAGTTTACTCGAGTAAACTGGCAGAGCTGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)