EMAIL THIS PAGE TO A FRIEND

CRB3

crumbs homolog 3 (Drosophila)

84 Gene Product Result for
UniProtKB ID: Q9BUF7, A8KA91, D6W643, Q8N0V8, Q8WVA0
Gene ID:
Human(92359) Summary: This gene encodes a member of the Crumbs family of proteins. This protein may play a role in epithelial cell polarity and is associated with tight junctions at the apical surface of epithelial cells. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(224912) crumbs homolog 3 (Drosophila)
Rat(301112) crumbs homolog 3 (Drosophila)
cow(787466) crumbs homolog 3 (Drosophila)
dog(611713) crumbs homolog 3 (Drosophila)
sheep(101108914) crumbs homolog 3 (Drosophila)
domestic guinea pig(100721189) crumbs homolog 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177638 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177638 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177638 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_139161 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139161 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139161 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU005311 MISSION® esiRNA esiRNA targeting mouse Crb3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139161 Rosetta Predictions human pricing
NM_174881 Rosetta Predictions human pricing
NM_001025661 Rosetta Predictions rat pricing
NM_177638 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193772 predicted 366
2 SASI_Hs01_00193773 predicted 280
3 SASI_Hs01_00193774 predicted 277
4 SASI_Hs01_00193775 predicted 766
5 SASI_Hs01_00193776 predicted 535
6 SASI_Hs01_00193777 predicted 427
7 SASI_Hs01_00193779 predicted 532
8 SASI_Hs01_00193780 predicted 281
9 SASI_Hs02_00364173 predicted 626
10 SASI_Hs02_00364174 predicted 276
11 SASI_Hs01_00193778 predicted 358
12 SASI_Hs01_00193781 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177559 predicted 365
2 SASI_Hs01_00177560 predicted 273
3 SASI_Hs01_00177561 predicted 275
4 SASI_Hs01_00177562 predicted 452
5 SASI_Hs01_00177563 predicted 479
6 SASI_Hs01_00177564 predicted 466
7 SASI_Hs01_00177565 predicted 418
8 SASI_Hs01_00177567 predicted 348
9 SASI_Hs01_00177568 predicted 275
10 SASI_Hs02_00368748 predicted 397
11 SASI_Hs01_00177566 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025661 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203244 predicted 711
2 SASI_Rn02_00203245 predicted 226
3 SASI_Rn01_00074975 predicted 222
4 SASI_Rn01_00074976 predicted 351
5 SASI_Rn01_00074977 predicted 647
6 SASI_Rn01_00074979 predicted 711
7 SASI_Rn01_00074980 predicted 227
8 SASI_Rn01_00074981 predicted 644
9 SASI_Rn01_00074982 predicted 728
10 SASI_Rn01_00074983 predicted 667
11 SASI_Rn01_00074978 predicted 786
12 SASI_Rn01_00074984 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177638 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083576 predicted 750
2 SASI_Mm01_00083578 predicted 274
3 SASI_Mm01_00083579 predicted 747
4 SASI_Mm01_00083581 predicted 397
5 SASI_Mm01_00083582 predicted 447
6 SASI_Mm01_00083583 predicted 746
7 SASI_Mm02_00347880 predicted 710
8 SASI_Mm01_00083584 predicted 675
9 SASI_Mm01_00083585 predicted 745
10 SASI_Mm02_00347881 predicted 776
11 SASI_Mm01_00083577 predicted 405
12 SASI_Mm01_00083580 predicted 279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177638
VALIDATED
CRB3 MISSION shRNA Bacterial Glycerol Stock
crumbs homolog 3 (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177638.4-273s21c1
Sequence:CCGGCGGACCCTTTCACAAATAGCACTCGAGTGCTATTTGTGAAAGGGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177638.4-823s21c1
Sequence:CCGGCCAACAAACCTCCTGTCCTTTCTCGAGAAAGGACAGGAGGTTTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177638.4-372s21c1
Sequence:CCGGTTCTGGGAGTCCTCCTTATAGCTCGAGCTATAAGGAGGACTCCCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177638.4-261s21c1
Sequence:CCGGGCCTAACAGCACCGGACCCTTCTCGAGAAGGGTCCGGTGCTGTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177638.4-339s21c1
Sequence:CCGGGGGCTATTGTAGCCATCACTGCTCGAGCAGTGATGGCTACAATAGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177638.3-823s1c1
Sequence:CCGGCCAACAAACCTCCTGTCCTTTCTCGAGAAAGGACAGGAGGTTTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177638.3-223s1c1
Sequence:CCGGCTTGGCGTTTGGTTTGCCGATCTCGAGATCGGCAAACCAAACGCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177638.3-261s1c1
Sequence:CCGGGCCTAACAGCACCGGACCCTTCTCGAGAAGGGTCCGGTGCTGTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177638.3-273s1c1
Sequence:CCGGCGGACCCTTTCACAAATAGCACTCGAGTGCTATTTGTGAAAGGGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177638
VALIDATED
CRB3 MISSION shRNA shRNA Plasmid DNA
crumbs homolog 3 (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177638.4-273s21c1
Sequence:CCGGCGGACCCTTTCACAAATAGCACTCGAGTGCTATTTGTGAAAGGGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177638.4-823s21c1
Sequence:CCGGCCAACAAACCTCCTGTCCTTTCTCGAGAAAGGACAGGAGGTTTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177638.4-372s21c1
Sequence:CCGGTTCTGGGAGTCCTCCTTATAGCTCGAGCTATAAGGAGGACTCCCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177638.4-261s21c1
Sequence:CCGGGCCTAACAGCACCGGACCCTTCTCGAGAAGGGTCCGGTGCTGTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177638.4-339s21c1
Sequence:CCGGGGGCTATTGTAGCCATCACTGCTCGAGCAGTGATGGCTACAATAGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177638.3-823s1c1
Sequence:CCGGCCAACAAACCTCCTGTCCTTTCTCGAGAAAGGACAGGAGGTTTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177638.3-223s1c1
Sequence:CCGGCTTGGCGTTTGGTTTGCCGATCTCGAGATCGGCAAACCAAACGCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177638.3-261s1c1
Sequence:CCGGGCCTAACAGCACCGGACCCTTCTCGAGAAGGGTCCGGTGCTGTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177638.3-273s1c1
Sequence:CCGGCGGACCCTTTCACAAATAGCACTCGAGTGCTATTTGTGAAAGGGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177638
VALIDATED
CRB3 MISSION shRNA Lentiviral Transduction Particles
crumbs homolog 3 (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177638.4-273s21c1
Sequence:CCGGCGGACCCTTTCACAAATAGCACTCGAGTGCTATTTGTGAAAGGGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177638.4-823s21c1
Sequence:CCGGCCAACAAACCTCCTGTCCTTTCTCGAGAAAGGACAGGAGGTTTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177638.4-372s21c1
Sequence:CCGGTTCTGGGAGTCCTCCTTATAGCTCGAGCTATAAGGAGGACTCCCAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177638.4-261s21c1
Sequence:CCGGGCCTAACAGCACCGGACCCTTCTCGAGAAGGGTCCGGTGCTGTTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177638.4-339s21c1
Sequence:CCGGGGGCTATTGTAGCCATCACTGCTCGAGCAGTGATGGCTACAATAGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177638.3-823s1c1
Sequence:CCGGCCAACAAACCTCCTGTCCTTTCTCGAGAAAGGACAGGAGGTTTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177638.3-223s1c1
Sequence:CCGGCTTGGCGTTTGGTTTGCCGATCTCGAGATCGGCAAACCAAACGCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177638.3-261s1c1
Sequence:CCGGGCCTAACAGCACCGGACCCTTCTCGAGAAGGGTCCGGTGCTGTTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177638.3-273s1c1
Sequence:CCGGCGGACCCTTTCACAAATAGCACTCGAGTGCTATTTGTGAAAGGGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139161
CRB3 MISSION shRNA Bacterial Glycerol Stock
crumbs homolog 3 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139161.2-336s1c1
Sequence:CCGGCAGAAGCCATCACTGCTATCACTCGAGTGATAGCAGTGATGGCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156153    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139161.2-800s1c1
Sequence:CCGGCCTCTCCTTTCTTTCAGTTCTCTCGAGAGAACTGAAAGAAAGGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139161.2-272s1c1
Sequence:CCGGGCAAATGAGAATAGCACTGTTCTCGAGAACAGTGCTATTCTCATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139161.2-899s1c1
Sequence:CCGGCTGCATCTGTCTCCCTTCATTCTCGAGAATGAAGGGAGACAGATGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139161.2-254s1c1
Sequence:CCGGCAAATACAGACCACTTCTGCACTCGAGTGCAGAAGTGGTCTGTATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139161.2-262s1c1
Sequence:CCGGGACCACTTCTGCAAATGAGAACTCGAGTTCTCATTTGCAGAAGTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139161.2-343s1c1
Sequence:CCGGCATCACTGCTATCATCGTGGTCTCGAGACCACGATGATAGCAGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139161.2-253s1c1
Sequence:CCGGGCAAATACAGACCACTTCTGCCTCGAGGCAGAAGTGGTCTGTATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139161.2-260s1c1
Sequence:CCGGCAGACCACTTCTGCAAATGAGCTCGAGCTCATTTGCAGAAGTGGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139161.2-912s1c1
Sequence:CCGGCCTTCATTGCTGTGTGACCTTCTCGAGAAGGTCACACAGCAATGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139161
CRB3 MISSION shRNA shRNA Plasmid DNA
crumbs homolog 3 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139161.2-336s1c1
Sequence:CCGGCAGAAGCCATCACTGCTATCACTCGAGTGATAGCAGTGATGGCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156153    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139161.2-800s1c1
Sequence:CCGGCCTCTCCTTTCTTTCAGTTCTCTCGAGAGAACTGAAAGAAAGGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139161.2-272s1c1
Sequence:CCGGGCAAATGAGAATAGCACTGTTCTCGAGAACAGTGCTATTCTCATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139161.2-899s1c1
Sequence:CCGGCTGCATCTGTCTCCCTTCATTCTCGAGAATGAAGGGAGACAGATGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139161.2-254s1c1
Sequence:CCGGCAAATACAGACCACTTCTGCACTCGAGTGCAGAAGTGGTCTGTATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139161.2-262s1c1
Sequence:CCGGGACCACTTCTGCAAATGAGAACTCGAGTTCTCATTTGCAGAAGTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139161.2-343s1c1
Sequence:CCGGCATCACTGCTATCATCGTGGTCTCGAGACCACGATGATAGCAGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139161.2-253s1c1
Sequence:CCGGGCAAATACAGACCACTTCTGCCTCGAGGCAGAAGTGGTCTGTATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139161.2-260s1c1
Sequence:CCGGCAGACCACTTCTGCAAATGAGCTCGAGCTCATTTGCAGAAGTGGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139161.2-912s1c1
Sequence:CCGGCCTTCATTGCTGTGTGACCTTCTCGAGAAGGTCACACAGCAATGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139161
CRB3 MISSION shRNA Lentiviral Transduction Particles
crumbs homolog 3 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139161.2-336s1c1
Sequence:CCGGCAGAAGCCATCACTGCTATCACTCGAGTGATAGCAGTGATGGCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156153    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139161.2-800s1c1
Sequence:CCGGCCTCTCCTTTCTTTCAGTTCTCTCGAGAGAACTGAAAGAAAGGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139161.2-272s1c1
Sequence:CCGGGCAAATGAGAATAGCACTGTTCTCGAGAACAGTGCTATTCTCATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139161.2-899s1c1
Sequence:CCGGCTGCATCTGTCTCCCTTCATTCTCGAGAATGAAGGGAGACAGATGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139161.2-254s1c1
Sequence:CCGGCAAATACAGACCACTTCTGCACTCGAGTGCAGAAGTGGTCTGTATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139161.2-262s1c1
Sequence:CCGGGACCACTTCTGCAAATGAGAACTCGAGTTCTCATTTGCAGAAGTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139161.2-343s1c1
Sequence:CCGGCATCACTGCTATCATCGTGGTCTCGAGACCACGATGATAGCAGTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139161.2-253s1c1
Sequence:CCGGGCAAATACAGACCACTTCTGCCTCGAGGCAGAAGTGGTCTGTATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139161.2-260s1c1
Sequence:CCGGCAGACCACTTCTGCAAATGAGCTCGAGCTCATTTGCAGAAGTGGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139161.2-912s1c1
Sequence:CCGGCCTTCATTGCTGTGTGACCTTCTCGAGAAGGTCACACAGCAATGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)