EMAIL THIS PAGE TO A FRIEND

CRCT1

cysteine-rich C-terminal 1

82 Gene Product Result for
Synonyms: C1orf42 NICE-1
UniProtKB ID: Q9UGL9, A4QN00, Q6IAD7
Gene ID:
Mouse(74175) cysteine-rich C-terminal 1
Rat(688401) cysteine-rich C-terminal 1
dog(609386) cysteine-rich C-terminal 1
cow(774026) cysteine-rich C-terminal 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301174 ANTI-CRCT1 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028798 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028798 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028798 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019060 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019060 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019060 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU010911 MISSION® esiRNA esiRNA targeting mouse Crct1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019060 Rosetta Predictions human pricing
XM_001066782 Rosetta Predictions rat pricing
NM_028798 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113748 predicted 271
2 SASI_Hs01_00113749 predicted 481
3 SASI_Hs01_00113750 predicted 476
4 SASI_Hs01_00113751 predicted 385
5 SASI_Hs01_00113753 predicted 312
6 SASI_Hs01_00113754 predicted 91
7 SASI_Hs01_00113756 predicted 264
8 SASI_Hs01_00113757 predicted 229
9 SASI_Hs02_00352647 predicted 476
10 SASI_Hs01_00113755 predicted 209
11 SASI_Hs01_00113752 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066782 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318712 predicted 203
2 SASI_Rn02_00318713 predicted 202
3 SASI_Rn02_00318714 predicted 137
4 SASI_Rn02_00318715 predicted 143
5 SASI_Rn02_00318716 predicted 149
6 SASI_Rn02_00318717 predicted 22
7 SASI_Rn02_00318718 predicted 104
8 SASI_Rn02_00318719 predicted 76
9 SASI_Rn02_00318720 predicted 206
10 SASI_Rn02_00318721 predicted 159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153039 predicted 340
2 SASI_Mm01_00153040 predicted 483
3 SASI_Mm01_00153041 predicted 329
4 SASI_Mm01_00153043 predicted 488
5 SASI_Mm01_00153044 predicted 486
6 SASI_Mm01_00153045 predicted 452
7 SASI_Mm01_00153046 predicted 415
8 SASI_Mm01_00153047 predicted 343
9 SASI_Mm01_00153048 predicted 484
10 SASI_Mm02_00334405 predicted 454
11 SASI_Mm01_00153042 predicted 445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028798
CRCT1 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich C-terminal 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028798.1-364s1c1
Sequence:CCGGCAACAATCAGAGTTCAGGCTGCTCGAGCAGCCTGAACTCTGATTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028798.1-496s1c1
Sequence:CCGGCTAGGAGTTTGGTTTCCCTTACTCGAGTAAGGGAAACCAAACTCCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028798.1-535s1c1
Sequence:CCGGGTTCAGAAACTTCACCCTGTTCTCGAGAACAGGGTGAAGTTTCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028798.1-357s1c1
Sequence:CCGGGCTCCTGCAACAATCAGAGTTCTCGAGAACTCTGATTGTTGCAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028798.1-358s1c1
Sequence:CCGGCTCCTGCAACAATCAGAGTTCCTCGAGGAACTCTGATTGTTGCAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028798
CRCT1 MISSION shRNA shRNA Plasmid DNA
cysteine-rich C-terminal 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028798.1-364s1c1
Sequence:CCGGCAACAATCAGAGTTCAGGCTGCTCGAGCAGCCTGAACTCTGATTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028798.1-496s1c1
Sequence:CCGGCTAGGAGTTTGGTTTCCCTTACTCGAGTAAGGGAAACCAAACTCCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028798.1-535s1c1
Sequence:CCGGGTTCAGAAACTTCACCCTGTTCTCGAGAACAGGGTGAAGTTTCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028798.1-357s1c1
Sequence:CCGGGCTCCTGCAACAATCAGAGTTCTCGAGAACTCTGATTGTTGCAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028798.1-358s1c1
Sequence:CCGGCTCCTGCAACAATCAGAGTTCCTCGAGGAACTCTGATTGTTGCAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028798
CRCT1 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich C-terminal 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028798.1-364s1c1
Sequence:CCGGCAACAATCAGAGTTCAGGCTGCTCGAGCAGCCTGAACTCTGATTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028798.1-496s1c1
Sequence:CCGGCTAGGAGTTTGGTTTCCCTTACTCGAGTAAGGGAAACCAAACTCCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028798.1-535s1c1
Sequence:CCGGGTTCAGAAACTTCACCCTGTTCTCGAGAACAGGGTGAAGTTTCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028798.1-357s1c1
Sequence:CCGGGCTCCTGCAACAATCAGAGTTCTCGAGAACTCTGATTGTTGCAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028798.1-358s1c1
Sequence:CCGGCTCCTGCAACAATCAGAGTTCCTCGAGGAACTCTGATTGTTGCAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019060
CRCT1 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich C-terminal 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019060.2-504s21c1
Sequence:CCGGGAAACCCACTTTGTTCTCAGCCTCGAGGCTGAGAACAAAGTGGGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019060.2-496s21c1
Sequence:CCGGGATGTTCAGAAACCCACTTTGCTCGAGCAAAGTGGGTTTCTGAACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019060.2-474s21c1
Sequence:CCGGCCCGTAAAGCGAATTGCACTTCTCGAGAAGTGCAATTCGCTTTACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019060.2-483s21c1
Sequence:CCGGCGAATTGCACTTTGATGTTCACTCGAGTGAACATCAAAGTGCAATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019060.2-512s21c1
Sequence:CCGGCTTTGTTCTCAGCCACGCAAACTCGAGTTTGCGTGGCTGAGAACAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019060
CRCT1 MISSION shRNA shRNA Plasmid DNA
cysteine-rich C-terminal 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019060.2-504s21c1
Sequence:CCGGGAAACCCACTTTGTTCTCAGCCTCGAGGCTGAGAACAAAGTGGGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019060.2-496s21c1
Sequence:CCGGGATGTTCAGAAACCCACTTTGCTCGAGCAAAGTGGGTTTCTGAACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019060.2-474s21c1
Sequence:CCGGCCCGTAAAGCGAATTGCACTTCTCGAGAAGTGCAATTCGCTTTACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019060.2-483s21c1
Sequence:CCGGCGAATTGCACTTTGATGTTCACTCGAGTGAACATCAAAGTGCAATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019060.2-512s21c1
Sequence:CCGGCTTTGTTCTCAGCCACGCAAACTCGAGTTTGCGTGGCTGAGAACAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019060
CRCT1 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich C-terminal 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019060.2-504s21c1
Sequence:CCGGGAAACCCACTTTGTTCTCAGCCTCGAGGCTGAGAACAAAGTGGGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019060.2-496s21c1
Sequence:CCGGGATGTTCAGAAACCCACTTTGCTCGAGCAAAGTGGGTTTCTGAACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019060.2-474s21c1
Sequence:CCGGCCCGTAAAGCGAATTGCACTTCTCGAGAAGTGCAATTCGCTTTACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019060.2-483s21c1
Sequence:CCGGCGAATTGCACTTTGATGTTCACTCGAGTGAACATCAAAGTGCAATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019060.2-512s21c1
Sequence:CCGGCTTTGTTCTCAGCCACGCAAACTCGAGTTTGCGTGGCTGAGAACAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)