EMAIL THIS PAGE TO A FRIEND

CRK

v-crk avian sarcoma virus CT10 oncogene homolog

173 Gene Product Result for
Synonyms: CRKII p38
UniProtKB ID: P46108, A8MWE8, B0LPE8, D3DTH6, Q96GA9, Q96HJ0
Gene ID:
Human(1398) Summary: This gene encodes a member of an adapter protein family that binds to several tyrosine-phosphorylated proteins. The product of this gene has several SH2 and SH3 domains (src-homology domains) and is involved in several signaling pathways, recruiting cytoplasmic proteins in the vicinity of tyrosine kinase through SH2-phosphotyrosine interaction. The N-terminal SH2 domain of this protein functions as a positive regulator of transformation whereas the C-terminal SH3 domain functions as a negative regulator of transformation. Two alternative transcripts encoding different isoforms with distinct biological activity have been described. [provided by RefSeq, Jul 2008]
Mouse(12928) v-crk sarcoma virus CT10 oncogene homolog (avian)
Rat(54245) v-crk avian sarcoma virus CT10 oncogene homolog
domestic guinea pig(100718486) v-crk sarcoma virus CT10 oncogene homolog (avian)
naked mole-rat(101717585) v-crk sarcoma virus CT10 oncogene homolog (avian)
sheep(101115380) v-crk sarcoma virus CT10 oncogene homolog (avian)
Zebrafish(445234) v-crk sarcoma virus CT10 oncogene homolog (avian)
fruit fly(248187) crooked setae
domestic cat(101086100) v-crk sarcoma virus CT10 oncogene homolog (avian)
cow(512841) v-crk sarcoma virus CT10 oncogene homolog (avian)
dog(100684309) v-crk sarcoma virus CT10 oncogene homolog (avian)
chicken(417553) v-crk sarcoma virus CT10 oncogene homolog
fruit fly(43775) CG1587 gene product from transcript CG1587-RD
Thale Cress(828087) actin related protein 2/3 complex, subunit 5
Thale Cress(824217) CDPK-related kinase
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405658 Anti-CRK antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
proximity ligation assay, western blot pricing
SAB1401085 Anti-CRK antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunofluorescence, proximity ligation assay, western blot pricing
HPA068087 Anti-CRK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
C0853 Anti-Crk-II antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution chicken, human, mouse
microarray, western blot pricing
SAB4500470 Anti-CRKII antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4503813 Anti-phospho-CrkII (pTyr221) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, western blot pricing
SAB5300124 Monoclonal Anti-CRK antibody produced in mouse clone 3G11C1, ascites fluid human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB5300125 Monoclonal Anti-CRK antibody produced in mouse clone 3G11E8, ascites fluid human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133656 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133656 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133656 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005206 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005206 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005206 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005206 Rosetta Predictions human pricing
NM_016823 Rosetta Predictions human pricing
NM_019302 Rosetta Predictions rat pricing
NM_133656 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152090 predicted 1210
2 SASI_Hs01_00152091 predicted 1221
3 SASI_Hs02_00339176 predicted 473
4 SASI_Hs01_00152089 predicted 420
5 SASI_Hs02_00339177 predicted 1132
6 SASI_Hs01_00152092 predicted 1199
7 SASI_Hs01_00152093 predicted 745
8 SASI_Hs01_00152094 predicted 861
9 SASI_Hs01_00152096 predicted 871
10 SASI_Hs01_00152097 predicted 963
11 SASI_Hs01_00152095 predicted 548
12 SASI_Hs01_00152098 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016823 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188561 predicted 1534
2 SASI_Hs01_00188562 predicted 1481
3 SASI_Hs01_00188564 predicted 1383
4 SASI_Hs01_00188566 predicted 1386
5 SASI_Hs01_00188568 predicted 472
6 SASI_Hs01_00188569 predicted 377
7 SASI_Hs01_00188570 predicted 1372
8 SASI_Hs02_00349881 predicted 1370
9 SASI_Hs02_00349882 predicted 1526
10 SASI_Hs02_00349883 predicted 1470
11 SASI_Hs01_00188563 predicted 426
12 SASI_Hs01_00188565 predicted 1502
13 SASI_Hs01_00188567 predicted 1311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019302 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068483 predicted 819
2 SASI_Rn01_00068484 predicted 371
3 SASI_Rn01_00068485 predicted 330
4 SASI_Rn01_00068486 predicted 508
5 SASI_Rn01_00068487 predicted 434
6 SASI_Rn01_00068488 predicted 448
7 SASI_Rn02_00262259 predicted 439
8 SASI_Rn01_00068490 predicted 790
9 SASI_Rn01_00068491 predicted 629
10 SASI_Rn01_00068492 predicted 706
11 SASI_Rn01_00068489 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133656 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083437 predicted 899
2 SASI_Mm01_00083438 predicted 1022
3 SASI_Mm01_00083439 predicted 818
4 SASI_Mm01_00083440 predicted 582
5 SASI_Mm01_00083441 predicted 509
6 SASI_Mm01_00083442 predicted 1103
7 SASI_Mm01_00083443 predicted 526
8 SASI_Mm01_00083444 predicted 1097
9 SASI_Mm01_00083445 predicted 1021
10 SASI_Mm01_00083446 predicted 510
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133656
VALIDATED
CRK MISSION shRNA Bacterial Glycerol Stock
v-crk avian sarcoma virus CT10 oncogene homolog
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133656.3-902s21c1
Sequence:CCGGTGGTAAAGGTTACGAAGATTACTCGAGTAATCTTCGTAACCTTTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133656.3-810s21c1
Sequence:CCGGCCTCCAGAATGGGCCCATTTACTCGAGTAAATGGGCCCATTCTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133656.3-1267s21c1
Sequence:CCGGCTGTATGAGAAGACGTAAATACTCGAGTATTTACGTCTTCTCATACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133656.3-1015s21c1
Sequence:CCGGGAGGACTTCAGCTGAGTATAGCTCGAGCTATACTCAGCTGAAGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133656.3-436s21c1
Sequence:CCGGTATTTGGACACTACAACATTGCTCGAGCAATGTTGTAGTGTCCAAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133656.2-377s1c1
Sequence:CCGGCGAATAGGAGATCAAGAATTTCTCGAGAAATTCTTGATCTCCTATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133656.2-901s1c1
Sequence:CCGGGCTGGTAAAGGTTACGAAGATCTCGAGATCTTCGTAACCTTTACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133656.2-586s1c1
Sequence:CCGGCATCCTGAGAATCCGGGATAACTCGAGTTATCCCGGATTCTCAGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133656.2-406s1c1
Sequence:CCGGGCCTGCTTTACTGGAATTCTACTCGAGTAGAATTCCAGTAAAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133656.2-995s1c1
Sequence:CCGGCTGGATCAACAGAATCCCGATCTCGAGATCGGGATTCTGTTGATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133656
VALIDATED
CRK MISSION shRNA shRNA Plasmid DNA
v-crk avian sarcoma virus CT10 oncogene homolog
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133656.3-902s21c1
Sequence:CCGGTGGTAAAGGTTACGAAGATTACTCGAGTAATCTTCGTAACCTTTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133656.3-810s21c1
Sequence:CCGGCCTCCAGAATGGGCCCATTTACTCGAGTAAATGGGCCCATTCTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133656.3-1267s21c1
Sequence:CCGGCTGTATGAGAAGACGTAAATACTCGAGTATTTACGTCTTCTCATACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133656.3-1015s21c1
Sequence:CCGGGAGGACTTCAGCTGAGTATAGCTCGAGCTATACTCAGCTGAAGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133656.3-436s21c1
Sequence:CCGGTATTTGGACACTACAACATTGCTCGAGCAATGTTGTAGTGTCCAAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133656.2-377s1c1
Sequence:CCGGCGAATAGGAGATCAAGAATTTCTCGAGAAATTCTTGATCTCCTATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133656.2-901s1c1
Sequence:CCGGGCTGGTAAAGGTTACGAAGATCTCGAGATCTTCGTAACCTTTACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133656.2-586s1c1
Sequence:CCGGCATCCTGAGAATCCGGGATAACTCGAGTTATCCCGGATTCTCAGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133656.2-406s1c1
Sequence:CCGGGCCTGCTTTACTGGAATTCTACTCGAGTAGAATTCCAGTAAAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133656.2-995s1c1
Sequence:CCGGCTGGATCAACAGAATCCCGATCTCGAGATCGGGATTCTGTTGATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133656
VALIDATED
CRK MISSION shRNA Lentiviral Transduction Particles
v-crk avian sarcoma virus CT10 oncogene homolog
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133656.3-902s21c1
Sequence:CCGGTGGTAAAGGTTACGAAGATTACTCGAGTAATCTTCGTAACCTTTACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133656.3-810s21c1
Sequence:CCGGCCTCCAGAATGGGCCCATTTACTCGAGTAAATGGGCCCATTCTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133656.3-1267s21c1
Sequence:CCGGCTGTATGAGAAGACGTAAATACTCGAGTATTTACGTCTTCTCATACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133656.3-1015s21c1
Sequence:CCGGGAGGACTTCAGCTGAGTATAGCTCGAGCTATACTCAGCTGAAGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133656.3-436s21c1
Sequence:CCGGTATTTGGACACTACAACATTGCTCGAGCAATGTTGTAGTGTCCAAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133656.2-377s1c1
Sequence:CCGGCGAATAGGAGATCAAGAATTTCTCGAGAAATTCTTGATCTCCTATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133656.2-901s1c1
Sequence:CCGGGCTGGTAAAGGTTACGAAGATCTCGAGATCTTCGTAACCTTTACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133656.2-586s1c1
Sequence:CCGGCATCCTGAGAATCCGGGATAACTCGAGTTATCCCGGATTCTCAGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133656.2-406s1c1
Sequence:CCGGGCCTGCTTTACTGGAATTCTACTCGAGTAGAATTCCAGTAAAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133656.2-995s1c1
Sequence:CCGGCTGGATCAACAGAATCCCGATCTCGAGATCGGGATTCTGTTGATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005206
VALIDATED
CRK MISSION shRNA Bacterial Glycerol Stock
v-crk avian sarcoma virus CT10 oncogene homolog
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005206.3-544s21c1
Sequence:CCGGGCGAGCCCTCTTTGACTTTAACTCGAGTTAAAGTCAAAGAGGGCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005206.3-428s21c1
Sequence:CCGGGCTTTACTGGAATTCTACAAACTCGAGTTTGTAGAATTCCAGTAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_005206.3-715s21c1
Sequence:CCGGCGCCTCAGTATCGGCTCTGATCTCGAGATCAGAGCCGATACTGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005206.3-604s21c1
Sequence:CCGGCATCTTGAGAATCCGGGACAACTCGAGTTGTCCCGGATTCTCAAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005206.3-544s1c1
Sequence:CCGGGCGAGCCCTCTTTGACTTTAACTCGAGTTAAAGTCAAAGAGGGCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005206.3-428s1c1
Sequence:CCGGGCTTTACTGGAATTCTACAAACTCGAGTTTGTAGAATTCCAGTAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005206.3-550s1c1
Sequence:CCGGCCTCTTTGACTTTAATGGGAACTCGAGTTCCCATTAAAGTCAAAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005206.3-604s1c1
Sequence:CCGGCATCTTGAGAATCCGGGACAACTCGAGTTGTCCCGGATTCTCAAGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005206.3-715s1c1
Sequence:CCGGCGCCTCAGTATCGGCTCTGATCTCGAGATCAGAGCCGATACTGAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005206
VALIDATED
CRK MISSION shRNA shRNA Plasmid DNA
v-crk avian sarcoma virus CT10 oncogene homolog
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005206.3-544s21c1
Sequence:CCGGGCGAGCCCTCTTTGACTTTAACTCGAGTTAAAGTCAAAGAGGGCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005206.3-428s21c1
Sequence:CCGGGCTTTACTGGAATTCTACAAACTCGAGTTTGTAGAATTCCAGTAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_005206.3-715s21c1
Sequence:CCGGCGCCTCAGTATCGGCTCTGATCTCGAGATCAGAGCCGATACTGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005206.3-604s21c1
Sequence:CCGGCATCTTGAGAATCCGGGACAACTCGAGTTGTCCCGGATTCTCAAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005206.3-544s1c1
Sequence:CCGGGCGAGCCCTCTTTGACTTTAACTCGAGTTAAAGTCAAAGAGGGCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005206.3-428s1c1
Sequence:CCGGGCTTTACTGGAATTCTACAAACTCGAGTTTGTAGAATTCCAGTAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005206.3-550s1c1
Sequence:CCGGCCTCTTTGACTTTAATGGGAACTCGAGTTCCCATTAAAGTCAAAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005206.3-604s1c1
Sequence:CCGGCATCTTGAGAATCCGGGACAACTCGAGTTGTCCCGGATTCTCAAGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005206.3-715s1c1
Sequence:CCGGCGCCTCAGTATCGGCTCTGATCTCGAGATCAGAGCCGATACTGAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005206
VALIDATED
CRK MISSION shRNA Lentiviral Transduction Particles
v-crk avian sarcoma virus CT10 oncogene homolog
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005206.3-544s21c1
Sequence:CCGGGCGAGCCCTCTTTGACTTTAACTCGAGTTAAAGTCAAAGAGGGCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005206.3-428s21c1
Sequence:CCGGGCTTTACTGGAATTCTACAAACTCGAGTTTGTAGAATTCCAGTAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_005206.3-715s21c1
Sequence:CCGGCGCCTCAGTATCGGCTCTGATCTCGAGATCAGAGCCGATACTGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005206.3-604s21c1
Sequence:CCGGCATCTTGAGAATCCGGGACAACTCGAGTTGTCCCGGATTCTCAAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005206.3-544s1c1
Sequence:CCGGGCGAGCCCTCTTTGACTTTAACTCGAGTTAAAGTCAAAGAGGGCTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005206.3-428s1c1
Sequence:CCGGGCTTTACTGGAATTCTACAAACTCGAGTTTGTAGAATTCCAGTAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005206.3-550s1c1
Sequence:CCGGCCTCTTTGACTTTAATGGGAACTCGAGTTCCCATTAAAGTCAAAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005206.3-604s1c1
Sequence:CCGGCATCTTGAGAATCCGGGACAACTCGAGTTGTCCCGGATTCTCAAGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005206.3-715s1c1
Sequence:CCGGCGCCTCAGTATCGGCTCTGATCTCGAGATCAGAGCCGATACTGAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)