EMAIL THIS PAGE TO A FRIEND

CRP

C-reactive protein, pentraxin-related

70 Gene Product Result for
Synonyms: PTX1
UniProtKB ID: P02741, A8K078, D3DVD9, D3DVE0, Q08AK3, Q8WW75
Gene ID:
Human(1401) Summary: The protein encoded by this gene belongs to the pentaxin family. It is involved in several host defense related functions based on its ability to recognize foreign pathogens and damaged cells of the host and to initiate their elimination by interacting with humoral and cellular effector systems in the blood. Consequently, the level of this protein in plasma increases greatly during acute phase response to tissue injury, infection, or other inflammatory stimuli. [provided by RefSeq, Sep 2009]
Mouse(12944) C-reactive protein, pentraxin-related
Rat(25419) C-reactive protein, pentraxin-related
Domestic Rabbit(100009091) C-reactive protein, pentraxin-related
naked mole-rat(101699046) C-reactive protein, pentraxin-related
domestic guinea pig(100727100) C-reactive protein, pentraxin-related
Zebrafish(751795) c-reactive protein, pentraxin-related
cow(527553) C-reactive protein, pentraxin-related
domestic cat(101093079) C-reactive protein, pentraxin-related
dog(488629) C-reactive protein, pentraxin-related
chicken(429786) C-reactive protein, pentraxin-related
chicken(776376) C-reactive protein, pentraxin-related
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000567 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000567 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000567 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007768 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007768 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007768 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000567 Rosetta Predictions human pricing
NM_017096 Rosetta Predictions rat pricing
NM_007768 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094761 predicted 356
2 SASI_Hs01_00094762 predicted 319
3 SASI_Hs01_00094763 predicted 722
4 SASI_Hs01_00094765 predicted 333
5 SASI_Hs01_00094766 predicted 687
6 SASI_Hs01_00094768 predicted 463
7 SASI_Hs01_00094769 predicted 230
8 SASI_Hs01_00094770 predicted 310
9 SASI_Hs02_00302812 predicted 563
10 SASI_Hs02_00302813 predicted 710
11 SASI_Hs01_00094764 predicted 614
12 SASI_Hs01_00094767 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081796 predicted 462
2 SASI_Rn02_00261312 predicted 351
3 SASI_Rn02_00261313 predicted 210
4 SASI_Rn02_00261314 predicted 217
5 SASI_Rn01_00081799 predicted 210
6 SASI_Rn02_00261315 predicted 382
7 SASI_Rn01_00081801 predicted 282
8 SASI_Rn02_00261316 predicted 345
9 SASI_Rn02_00261317 predicted 283
10 SASI_Rn02_00261318 predicted 372
11 SASI_Rn01_00081795 predicted 640
12 SASI_Rn01_00081797 predicted 933
13 SASI_Rn01_00081798 predicted 883
14 SASI_Rn01_00081800 predicted 609
15 SASI_Rn01_00081802 predicted 575
16 SASI_Rn01_00081803 predicted 588
17 SASI_Rn01_00081804 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007768 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083786 predicted 310
2 SASI_Mm02_00312398 predicted 457
3 SASI_Mm01_00083790 predicted 444
4 SASI_Mm01_00083791 predicted 217
5 SASI_Mm01_00083792 predicted 336
6 SASI_Mm02_00312399 predicted 237
7 SASI_Mm02_00312400 predicted 584
8 SASI_Mm02_00312401 predicted 754
9 SASI_Mm02_00312402 predicted 617
10 SASI_Mm01_00083794 predicted 382
11 SASI_Mm01_00083785 predicted 629
12 SASI_Mm01_00083787 predicted 452
13 SASI_Mm01_00083788 predicted 598
14 SASI_Mm01_00083789 predicted 753
15 SASI_Mm01_00083793 predicted 619
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000567
CRP MISSION shRNA Bacterial Glycerol Stock
C-reactive protein, pentraxin-related
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000567.2-663s1c1
Sequence:CCGGGATGAGATTAACACCATCTATCTCGAGATAGATGGTGTTAATCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000567.2-1164s1c1
Sequence:CCGGGCGCTGATCTTCTATTTAATTCTCGAGAATTAAATAGAAGATCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000567.2-723s1c1
Sequence:CCGGGCACTGAAGTATGAAGTGCAACTCGAGTTGCACTTCATACTTCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000567.2-321s1c1
Sequence:CCGGGCCACCAAGAGACAAGACAATCTCGAGATTGTCTTGTCTCTTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000567.2-231s1c1
Sequence:CCGGCCGTTAACGAAGCCTCTCAAACTCGAGTTTGAGAGGCTTCGTTAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000567.2-291s21c1
Sequence:CCGGTCGACCCGTGGGTACAGTATTCTCGAGAATACTGTACCCACGGGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000567.2-427s21c1
Sequence:CCGGCAGTAGCTCCAGTACACATTTCTCGAGAAATGTGTACTGGAGCTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000567
CRP MISSION shRNA shRNA Plasmid DNA
C-reactive protein, pentraxin-related
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000567.2-663s1c1
Sequence:CCGGGATGAGATTAACACCATCTATCTCGAGATAGATGGTGTTAATCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000567.2-1164s1c1
Sequence:CCGGGCGCTGATCTTCTATTTAATTCTCGAGAATTAAATAGAAGATCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000567.2-723s1c1
Sequence:CCGGGCACTGAAGTATGAAGTGCAACTCGAGTTGCACTTCATACTTCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000567.2-321s1c1
Sequence:CCGGGCCACCAAGAGACAAGACAATCTCGAGATTGTCTTGTCTCTTGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000567.2-231s1c1
Sequence:CCGGCCGTTAACGAAGCCTCTCAAACTCGAGTTTGAGAGGCTTCGTTAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000567.2-291s21c1
Sequence:CCGGTCGACCCGTGGGTACAGTATTCTCGAGAATACTGTACCCACGGGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000567.2-427s21c1
Sequence:CCGGCAGTAGCTCCAGTACACATTTCTCGAGAAATGTGTACTGGAGCTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000567
CRP MISSION shRNA Lentiviral Transduction Particles
C-reactive protein, pentraxin-related
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000567.2-663s1c1
Sequence:CCGGGATGAGATTAACACCATCTATCTCGAGATAGATGGTGTTAATCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000567.2-1164s1c1
Sequence:CCGGGCGCTGATCTTCTATTTAATTCTCGAGAATTAAATAGAAGATCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000567.2-723s1c1
Sequence:CCGGGCACTGAAGTATGAAGTGCAACTCGAGTTGCACTTCATACTTCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000567.2-321s1c1
Sequence:CCGGGCCACCAAGAGACAAGACAATCTCGAGATTGTCTTGTCTCTTGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000567.2-231s1c1
Sequence:CCGGCCGTTAACGAAGCCTCTCAAACTCGAGTTTGAGAGGCTTCGTTAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000567.2-291s21c1
Sequence:CCGGTCGACCCGTGGGTACAGTATTCTCGAGAATACTGTACCCACGGGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000567.2-427s21c1
Sequence:CCGGCAGTAGCTCCAGTACACATTTCTCGAGAAATGTGTACTGGAGCTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007768
CRP MISSION shRNA Bacterial Glycerol Stock
C-reactive protein, pentraxin-related
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007768.2-375s1c1
Sequence:CCGGCGATTCATGGTTTCAGAGATTCTCGAGAATCTCTGAAACCATGAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007768.2-268s1c1
Sequence:CCGGGCAGCTTCAGTGTCTTCTCTTCTCGAGAAGAGAAGACACTGAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007768.2-512s1c1
Sequence:CCGGGCCAGATGCAAGCATCATCTTCTCGAGAAGATGATGCTTGCATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007768.2-104s1c1
Sequence:CCGGGATCAGCTTCTCTCGGACTTTCTCGAGAAAGTCCGAGAGAAGCTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007768.2-708s1c1
Sequence:CCGGGCACAGGGTGATGTGTTTATTCTCGAGAATAAACACATCACCCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007768
CRP MISSION shRNA shRNA Plasmid DNA
C-reactive protein, pentraxin-related
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007768.2-375s1c1
Sequence:CCGGCGATTCATGGTTTCAGAGATTCTCGAGAATCTCTGAAACCATGAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007768.2-268s1c1
Sequence:CCGGGCAGCTTCAGTGTCTTCTCTTCTCGAGAAGAGAAGACACTGAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007768.2-512s1c1
Sequence:CCGGGCCAGATGCAAGCATCATCTTCTCGAGAAGATGATGCTTGCATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007768.2-104s1c1
Sequence:CCGGGATCAGCTTCTCTCGGACTTTCTCGAGAAAGTCCGAGAGAAGCTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007768.2-708s1c1
Sequence:CCGGGCACAGGGTGATGTGTTTATTCTCGAGAATAAACACATCACCCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007768
CRP MISSION shRNA Lentiviral Transduction Particles
C-reactive protein, pentraxin-related
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007768.2-375s1c1
Sequence:CCGGCGATTCATGGTTTCAGAGATTCTCGAGAATCTCTGAAACCATGAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007768.2-268s1c1
Sequence:CCGGGCAGCTTCAGTGTCTTCTCTTCTCGAGAAGAGAAGACACTGAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007768.2-512s1c1
Sequence:CCGGGCCAGATGCAAGCATCATCTTCTCGAGAAGATGATGCTTGCATCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007768.2-104s1c1
Sequence:CCGGGATCAGCTTCTCTCGGACTTTCTCGAGAAAGTCCGAGAGAAGCTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007768.2-708s1c1
Sequence:CCGGGCACAGGGTGATGTGTTTATTCTCGAGAATAAACACATCACCCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)