EMAIL THIS PAGE TO A FRIEND

CRY2

cryptochrome 2 (photolyase-like)

85 Gene Product Result for
Synonyms: HCRY2 PHLL2
UniProtKB ID: Q49AN0, B4DH32, O75148, Q8IV71
Gene ID:
Mouse(12953) cryptochrome 2 (photolyase-like)
Rat(170917) cryptochrome 2 (photolyase-like)
Thale Cress(839529) cryptochrome 2
domestic cat(101084825) cryptochrome 2 (photolyase-like)
dog(483641) cryptochrome 2 (photolyase-like)
chicken(374092) cryptochrome 2 (photolyase-like)
naked mole-rat(101707595) cryptochrome 2 (photolyase-like)
domestic guinea pig(100724908) cryptochrome 2 (photolyase-like)
sheep(100169934) cryptochrome 2 (photolyase-like)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021117 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021117 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021117 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009963 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009963 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009963 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127457 Rosetta Predictions human pricing
NM_021117 Rosetta Predictions human pricing
NM_133405 Rosetta Predictions rat pricing
NM_001113333 Rosetta Predictions mouse pricing
NM_009963 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329574 predicted 1211
2 SASI_Hs02_00329575 predicted 854
3 SASI_Hs02_00329576 predicted 372
4 SASI_Hs02_00329577 predicted 409
5 SASI_Hs02_00329578 predicted 1020
6 SASI_Hs02_00329579 predicted 365
7 SASI_Hs02_00329580 predicted 1287
8 SASI_Hs02_00329581 predicted 1383
9 SASI_Hs02_00329582 predicted 1296
10 SASI_Hs02_00329583 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076369 predicted 1346
2 SASI_Hs01_00076370 predicted 991
3 SASI_Hs01_00076371 predicted 506
4 SASI_Hs02_00354614 predicted 540
5 SASI_Hs02_00354615 predicted 1165
6 SASI_Hs02_00354616 predicted 500
7 SASI_Hs02_00354617 predicted 1430
8 SASI_Hs01_00076372 predicted 1519
9 SASI_Hs01_00076374 predicted 1428
10 SASI_Hs02_00354618 predicted 499
11 SASI_Hs01_00076373 predicted 406
12 SASI_Hs01_00076375 predicted 678
13 SASI_Hs01_00076376 predicted 2217
14 SASI_Hs01_00076377 predicted 1530
15 SASI_Hs01_00076378 predicted 1522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133405 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120643 predicted 467
2 SASI_Rn01_00120644 predicted 1483
3 SASI_Rn02_00267663 predicted 354
4 SASI_Rn01_00120645 predicted 400
5 SASI_Rn01_00120646 predicted 869
6 SASI_Rn01_00120647 predicted 1354
7 SASI_Rn02_00267664 predicted 302
8 SASI_Rn01_00120648 predicted 579
9 SASI_Rn01_00120649 predicted 1504
10 SASI_Rn01_00120650 predicted 1433
11 SASI_Rn01_00120642 predicted 780
12 SASI_Rn01_00120651 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113333 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307393 predicted 493
2 SASI_Mm02_00307394 predicted 301
3 SASI_Mm02_00307395 predicted 375
4 SASI_Mm02_00307396 predicted 497
5 SASI_Mm02_00307397 predicted 1518
6 SASI_Mm02_00307398 predicted 393
7 SASI_Mm02_00307399 predicted 433
8 SASI_Mm02_00307400 predicted 1475
9 SASI_Mm02_00307401 predicted 1456
10 SASI_Mm02_00307402 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009963 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155931 predicted 486
2 SASI_Mm01_00155933 predicted 301
3 SASI_Mm01_00155934 predicted 380
4 SASI_Mm01_00155935 predicted 501
5 SASI_Mm01_00155936 predicted 1519
6 SASI_Mm02_00317529 predicted 400
7 SASI_Mm01_00155938 predicted 429
8 SASI_Mm01_00155939 predicted 1469
9 SASI_Mm02_00317530 predicted 1457
10 SASI_Mm01_00155940 predicted 953
11 SASI_Mm01_00155932 predicted 1850
12 SASI_Mm01_00155937 predicted 1770
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021117
VALIDATED
CRY2 MISSION shRNA Bacterial Glycerol Stock
cryptochrome 2 (photolyase-like)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021117.3-1509s21c1
Sequence:CCGGAGGCAGCCAAGTGCATCATTGCTCGAGCAATGATGCACTTGGCTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021117.3-2038s21c1
Sequence:CCGGATCTGTTGACACTCATGATTCCTCGAGGAATCATGAGTGTCAACAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021117.3-944s21c1
Sequence:CCGGCGCCTGTGGGACCTGTATAAACTCGAGTTTATACAGGTCCCACAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021117.1-3672s1c1
Sequence:CCGGGCCCAGATTTAGTATTCACTACTCGAGTAGTGAATACTAAATCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021117.1-1501s1c1
Sequence:CCGGCCGGCTTAACATTGAACGAATCTCGAGATTCGTTCAATGTTAAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021117.1-434s1c1
Sequence:CCGGGTGGAAGTAGTGACGGAGAATCTCGAGATTCTCCGTCACTACTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021117.1-259s1c1
Sequence:CCGGCACAAGTTTAAGGAAACTGAACTCGAGTTCAGTTTCCTTAAACTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021117.1-1366s1c1
Sequence:CCGGCCTGCCCAAATTGAAAGCGTTCTCGAGAACGCTTTCAATTTGGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021117.3-582s21c1
Sequence:CCGGCCCTTACATACAAGCGCTTTCCTCGAGGAAAGCGCTTGTATGTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021117.3-506s21c1
Sequence:CCGGGTGGAAGTAGTGACGGAGAATCTCGAGATTCTCCGTCACTACTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021117
VALIDATED
CRY2 MISSION shRNA shRNA Plasmid DNA
cryptochrome 2 (photolyase-like)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021117.3-1509s21c1
Sequence:CCGGAGGCAGCCAAGTGCATCATTGCTCGAGCAATGATGCACTTGGCTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021117.3-2038s21c1
Sequence:CCGGATCTGTTGACACTCATGATTCCTCGAGGAATCATGAGTGTCAACAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021117.3-944s21c1
Sequence:CCGGCGCCTGTGGGACCTGTATAAACTCGAGTTTATACAGGTCCCACAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021117.1-3672s1c1
Sequence:CCGGGCCCAGATTTAGTATTCACTACTCGAGTAGTGAATACTAAATCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021117.1-1501s1c1
Sequence:CCGGCCGGCTTAACATTGAACGAATCTCGAGATTCGTTCAATGTTAAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021117.1-434s1c1
Sequence:CCGGGTGGAAGTAGTGACGGAGAATCTCGAGATTCTCCGTCACTACTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021117.1-259s1c1
Sequence:CCGGCACAAGTTTAAGGAAACTGAACTCGAGTTCAGTTTCCTTAAACTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021117.1-1366s1c1
Sequence:CCGGCCTGCCCAAATTGAAAGCGTTCTCGAGAACGCTTTCAATTTGGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021117.3-582s21c1
Sequence:CCGGCCCTTACATACAAGCGCTTTCCTCGAGGAAAGCGCTTGTATGTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021117.3-506s21c1
Sequence:CCGGGTGGAAGTAGTGACGGAGAATCTCGAGATTCTCCGTCACTACTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021117
VALIDATED
CRY2 MISSION shRNA Lentiviral Transduction Particles
cryptochrome 2 (photolyase-like)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021117.3-1509s21c1
Sequence:CCGGAGGCAGCCAAGTGCATCATTGCTCGAGCAATGATGCACTTGGCTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021117.3-2038s21c1
Sequence:CCGGATCTGTTGACACTCATGATTCCTCGAGGAATCATGAGTGTCAACAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021117.3-944s21c1
Sequence:CCGGCGCCTGTGGGACCTGTATAAACTCGAGTTTATACAGGTCCCACAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021117.1-3672s1c1
Sequence:CCGGGCCCAGATTTAGTATTCACTACTCGAGTAGTGAATACTAAATCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021117.1-1501s1c1
Sequence:CCGGCCGGCTTAACATTGAACGAATCTCGAGATTCGTTCAATGTTAAGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021117.1-434s1c1
Sequence:CCGGGTGGAAGTAGTGACGGAGAATCTCGAGATTCTCCGTCACTACTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021117.1-259s1c1
Sequence:CCGGCACAAGTTTAAGGAAACTGAACTCGAGTTCAGTTTCCTTAAACTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021117.1-1366s1c1
Sequence:CCGGCCTGCCCAAATTGAAAGCGTTCTCGAGAACGCTTTCAATTTGGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021117.3-582s21c1
Sequence:CCGGCCCTTACATACAAGCGCTTTCCTCGAGGAAAGCGCTTGTATGTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021117.3-506s21c1
Sequence:CCGGGTGGAAGTAGTGACGGAGAATCTCGAGATTCTCCGTCACTACTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009963
VALIDATED
CRY2 MISSION shRNA Bacterial Glycerol Stock
cryptochrome 2 (photolyase-like)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009963.3-771s1c1
Sequence:CCGGCGGATGAATGCCAATTCCTTACTCGAGTAAGGAATTGGCATTCATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009963.4-3574s21c1
Sequence:CCGGCTGCGTCCAGGATTTAGTTTGCTCGAGCAAACTAAATCCTGGACGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009963.4-3213s21c1
Sequence:CCGGTCCTAGCCTCAGAGTTGTTAACTCGAGTTAACAACTCTGAGGCTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009963.3-354s1c1
Sequence:CCGGGAATATGACTCTGAACCCTTTCTCGAGAAAGGGTTCAGAGTCATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009963.3-1493s1c1
Sequence:CCGGGCTCAACATTGAACGAATGAACTCGAGTTCATTCGTTCAATGTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009963.4-3433s21c1
Sequence:CCGGCACCTGTGATGTCCATGTTTACTCGAGTAAACATGGACATCACAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009963.4-3645s1c1
Sequence:CCGGGGTTCTCTTCACAAGGTATAACTCGAGTTATACCTTGTGAAGAGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009963.4-2151s21c1
Sequence:CCGGTGGTAGTACCCTAGCTCAAATCTCGAGATTTGAGCTAGGGTACTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009963.4-2095s21c1
Sequence:CCGGGTAGTGACTTTCAGCCCAAATCTCGAGATTTGGGCTGAAAGTCACTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009963
VALIDATED
CRY2 MISSION shRNA shRNA Plasmid DNA
cryptochrome 2 (photolyase-like)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009963.3-771s1c1
Sequence:CCGGCGGATGAATGCCAATTCCTTACTCGAGTAAGGAATTGGCATTCATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009963.4-3574s21c1
Sequence:CCGGCTGCGTCCAGGATTTAGTTTGCTCGAGCAAACTAAATCCTGGACGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009963.4-3213s21c1
Sequence:CCGGTCCTAGCCTCAGAGTTGTTAACTCGAGTTAACAACTCTGAGGCTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009963.3-354s1c1
Sequence:CCGGGAATATGACTCTGAACCCTTTCTCGAGAAAGGGTTCAGAGTCATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009963.3-1493s1c1
Sequence:CCGGGCTCAACATTGAACGAATGAACTCGAGTTCATTCGTTCAATGTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009963.4-3433s21c1
Sequence:CCGGCACCTGTGATGTCCATGTTTACTCGAGTAAACATGGACATCACAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009963.4-3645s1c1
Sequence:CCGGGGTTCTCTTCACAAGGTATAACTCGAGTTATACCTTGTGAAGAGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009963.4-2151s21c1
Sequence:CCGGTGGTAGTACCCTAGCTCAAATCTCGAGATTTGAGCTAGGGTACTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009963.4-2095s21c1
Sequence:CCGGGTAGTGACTTTCAGCCCAAATCTCGAGATTTGGGCTGAAAGTCACTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009963
VALIDATED
CRY2 MISSION shRNA Lentiviral Transduction Particles
cryptochrome 2 (photolyase-like)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009963.3-771s1c1
Sequence:CCGGCGGATGAATGCCAATTCCTTACTCGAGTAAGGAATTGGCATTCATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009963.4-3574s21c1
Sequence:CCGGCTGCGTCCAGGATTTAGTTTGCTCGAGCAAACTAAATCCTGGACGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009963.4-3213s21c1
Sequence:CCGGTCCTAGCCTCAGAGTTGTTAACTCGAGTTAACAACTCTGAGGCTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009963.3-354s1c1
Sequence:CCGGGAATATGACTCTGAACCCTTTCTCGAGAAAGGGTTCAGAGTCATATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009963.3-1493s1c1
Sequence:CCGGGCTCAACATTGAACGAATGAACTCGAGTTCATTCGTTCAATGTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009963.4-3433s21c1
Sequence:CCGGCACCTGTGATGTCCATGTTTACTCGAGTAAACATGGACATCACAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009963.4-3645s1c1
Sequence:CCGGGGTTCTCTTCACAAGGTATAACTCGAGTTATACCTTGTGAAGAGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009963.4-2151s21c1
Sequence:CCGGTGGTAGTACCCTAGCTCAAATCTCGAGATTTGAGCTAGGGTACTACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009963.4-2095s21c1
Sequence:CCGGGTAGTGACTTTCAGCCCAAATCTCGAGATTTGGGCTGAAAGTCACTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)