EMAIL THIS PAGE TO A FRIEND

CSAG2

CSAG family, member 2

62 Gene Product Result for
Synonyms: CSAG3B CT24.2 TRAG-3 TRAG3
Species: Human CSAG2(728461)
UniProtKB ID: Q9Y5P2, O75605, Q0VDC3, Q96IU8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306323 ANTI-CSAG2(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004909 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004909 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004909 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080848 Rosetta Predictions human pricing
NM_004909 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316119 predicted 619
2 SASI_Hs02_00316120 predicted 666
3 SASI_Hs02_00316121 predicted 448
4 SASI_Hs02_00316122 predicted 318
5 SASI_Hs02_00316123 predicted 308
6 SASI_Hs02_00316124 predicted 453
7 SASI_Hs02_00316125 predicted 446
8 SASI_Hs02_00316126 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075904 predicted 568
2 SASI_Hs02_00338564 predicted 621
3 SASI_Hs02_00338565 predicted 316
4 SASI_Hs02_00338566 predicted 315
5 SASI_Hs01_00075901 predicted 615
6 SASI_Hs01_00075902 predicted 598
7 SASI_Hs01_00075903 predicted 455
8 SASI_Hs01_00075905 predicted 319
9 SASI_Hs01_00075906 predicted 326
10 SASI_Hs01_00075907 predicted 427
11 SASI_Hs01_00075908 predicted 414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004909
CSAG2 MISSION shRNA Bacterial Glycerol Stock
CSAG family, member 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000115812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004909.1-554s1c1
Sequence:CCGGCGAACGAGGAACTCAATCAAACTCGAGTTTGATTGAGTTCCTCGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004909.1-409s1c1
Sequence:CCGGCCAAAGAGGTTCCCAAGACAACTCGAGTTGTCTTGGGAACCTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004909.1-225s1c1
Sequence:CCGGCTACCACAAGACTAACATAAACTCGAGTTTATGTTAGTCTTGTGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004909.1-453s1c1
Sequence:CCGGCGAGGAAGTTCCAGGAACAAACTCGAGTTTGTTCCTGGAACTTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004909
CSAG2 MISSION shRNA shRNA Plasmid DNA
CSAG family, member 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000115812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004909.1-554s1c1
Sequence:CCGGCGAACGAGGAACTCAATCAAACTCGAGTTTGATTGAGTTCCTCGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004909.1-409s1c1
Sequence:CCGGCCAAAGAGGTTCCCAAGACAACTCGAGTTGTCTTGGGAACCTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004909.1-225s1c1
Sequence:CCGGCTACCACAAGACTAACATAAACTCGAGTTTATGTTAGTCTTGTGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004909.1-453s1c1
Sequence:CCGGCGAGGAAGTTCCAGGAACAAACTCGAGTTTGTTCCTGGAACTTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004909
CSAG2 MISSION shRNA Lentiviral Transduction Particles
CSAG family, member 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000115812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004909.1-554s1c1
Sequence:CCGGCGAACGAGGAACTCAATCAAACTCGAGTTTGATTGAGTTCCTCGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004909.1-409s1c1
Sequence:CCGGCCAAAGAGGTTCCCAAGACAACTCGAGTTGTCTTGGGAACCTCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004909.1-225s1c1
Sequence:CCGGCTACCACAAGACTAACATAAACTCGAGTTTATGTTAGTCTTGTGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004909.1-453s1c1
Sequence:CCGGCGAGGAAGTTCCAGGAACAAACTCGAGTTTGTTCCTGGAACTTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)