EMAIL THIS PAGE TO A FRIEND

CSNK2A1

casein kinase 2, alpha 1 polypeptide

116 Gene Product Result for
Synonyms: CK2A1 CKII CSNK2A3
Gene ID:
Human(1457) Summary: Casein kinase II is a serine/threonine protein kinase that phosphorylates acidic proteins such as casein. The kinase exists as a tetramer and is composed of an alpha, an alpha-prime, and two beta subunits. The alpha subunits contain the catalytic activity while the beta subunits undergo autophosphorylation. The protein encoded by this gene represents the alpha subunit. While this gene is found on chromosome 20, a related transcribed pseudogene is found on chromosome 11. Three transcript variants encoding two different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(12995) casein kinase 2, alpha 1 polypeptide
Rat(116549) casein kinase 2, alpha 1 polypeptide
sheep(101121957) casein kinase 2, alpha 1 polypeptide
domestic guinea pig(100714882) casein kinase 2, alpha 1 polypeptide
naked mole-rat(101724504) casein kinase 2, alpha 1 polypeptide
chicken(432370) casein kinase 2, alpha 1 polypeptide
dog(477185) casein kinase 2, alpha 1 polypeptide
Horse(100146834) casein kinase 2, alpha 1 polypeptide
cow(282419) casein kinase 2, alpha 1 polypeptide
domestic cat(101084186) casein kinase 2, alpha 1 polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500514 Anti-Casein Kinase II α antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4300629 Anti-CK2α antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB1301350 ANTI-CKII ALPHA (CSNK2A1) (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
C3994 Anti-CSNK2A1 (11-25) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2100492 Anti-CSNK2A1 antibody produced in rabbit affinity isolated antibody horse, human, rat, rabbit, mouse, guinea pig, zebrafish, Caenorhabditis elegans, rabbit
western blot pricing
SAB1410252 Anti-CSNK2A1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA059206 Anti-CSNK2A1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB1304741 ANTI-MOUSE CSNK2A1 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4504299 Anti-phospho-Casein Kinase II α (pTyr255) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4301659 Anti-TSPY1/TSPY3 affinity isolated antibody human
immunohistochemistry pricing
C5367 Monoclonal Anti-Casein Kinase 2α antibody produced in mouse ~2 mg/mL, clone 1AD9, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunoprecipitation (IP), microarray, western blot pricing
WH0001457M1 Monoclonal Anti-CSNK2A1 antibody produced in mouse clone 3D9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, proximity ligation assay, western blot pricing
PLA0065 Rabbit anti-CKII alpha Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. toad, rat, horse, rabbit, human, dog, toad, chicken, turkey, mouse, bovine, guinea pig
proximity ligation assay, western blot pricing

Small Molecule - Substrate

Product # Description Species Add to Cart
 
A2793 Arg-Arg-Arg-Glu-Glu-Glu-Thr-Glu-Glu-Glu lyophilized powder human, mouse, rat pricing
C2460 Casein Kinase II substrate ≥97% (HPLC) human, mouse, rat pricing

Kits

Product # Description Species Add to Cart
 
CS0610 Casein Kinase II Assay Kit sufficient for 70 reactions human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177559 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177559 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177559 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001895 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001895 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001895 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007788 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007788 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007788 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001895 siRNAs that have been validated in the lab human pricing
NM_177559 Rosetta Predictions human pricing
NM_177560 Rosetta Predictions human pricing
NM_053824 Rosetta Predictions rat pricing
NM_007788 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001895 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110178 validated 850
1 SASI_Hs01_00110179 validated 764
1 SASI_Hs01_00110180 validated 910
2 SASI_Hs01_00110181 predicted 1061
3 SASI_Hs01_00110183 predicted 927
4 SASI_Hs01_00110184 predicted 652
5 SASI_Hs01_00110185 predicted 943
6 SASI_Hs01_00110186 predicted 1189
7 SASI_Hs02_00332762 predicted 899
8 SASI_Hs02_00332763 predicted 1211
9 SASI_Hs01_00110182 predicted 1057
10 SASI_Hs01_00110187 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205271 predicted 960
2 SASI_Hs01_00205272 predicted 879
3 SASI_Hs01_00205273 predicted 1023
4 SASI_Hs01_00205274 predicted 1176
5 SASI_Hs01_00205276 predicted 1040
6 SASI_Hs01_00205277 predicted 763
7 SASI_Hs01_00205278 predicted 1060
8 SASI_Hs01_00205279 predicted 1301
9 SASI_Hs02_00369405 predicted 1011
10 SASI_Hs02_00369406 predicted 1320
11 SASI_Hs01_00205275 predicted 1171
12 SASI_Hs01_00205280 predicted 1029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177560 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214151 predicted 632
2 SASI_Hs01_00214152 predicted 545
3 SASI_Hs01_00214153 predicted 699
4 SASI_Hs01_00214154 predicted 854
5 SASI_Hs01_00214156 predicted 720
6 SASI_Hs01_00214157 predicted 725
7 SASI_Hs01_00214158 predicted 973
8 SASI_Hs01_00214160 predicted 688
9 SASI_Hs02_00369407 predicted 993
10 SASI_Hs02_00369408 predicted 563
11 SASI_Hs01_00214155 predicted 838
12 SASI_Hs01_00214159 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053824 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266657 predicted 202
2 SASI_Rn01_00051444 predicted 683
3 SASI_Rn01_00051445 predicted 837
4 SASI_Rn01_00051446 predicted 803
5 SASI_Rn01_00051447 predicted 953
6 SASI_Rn01_00051448 predicted 1212
7 SASI_Rn01_00051451 predicted 846
8 SASI_Rn01_00051452 predicted 943
9 SASI_Rn02_00266658 predicted 797
10 SASI_Rn02_00266659 predicted 486
11 SASI_Rn01_00051449 predicted 829
12 SASI_Rn01_00051450 predicted 1305
13 SASI_Rn01_00051453 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007788 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312464 predicted 283
2 SASI_Mm01_00193835 predicted 897
3 SASI_Mm01_00193830 predicted 1005
4 SASI_Mm01_00193837 predicted 758
5 SASI_Mm01_00193838 predicted 882
6 SASI_Mm02_00312465 predicted 1253
7 SASI_Mm02_00312466 predicted 284
8 SASI_Mm01_00193831 predicted 328
9 SASI_Mm01_00193832 predicted 1020
10 SASI_Mm02_00312467 predicted 367
11 SASI_Mm01_00193833 predicted 587
12 SASI_Mm01_00193834 predicted 312
13 SASI_Mm01_00193836 predicted 327
14 SASI_Mm01_00193839 predicted 945
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177559
VALIDATED
CSNK2A1 MISSION shRNA Bacterial Glycerol Stock
casein kinase 2, alpha 1 polypeptide
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177559.x-650s1c1
Sequence:CCGGAGAATTTGAGAGGAGGTCCCACTCGAGTGGGACCTCCTCTCAAATTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177559.x-949s1c1
Sequence:CCGGCAAGAATATAATGTCCGAGTTCTCGAGAACTCGGACATTATATTCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001986    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177559.x-1906s1c1
Sequence:CCGGGCTGCATTTAGGTGGAGACTTCTCGAGAAGTCTCCACCTAAATGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177559.x-948s1c1
Sequence:CCGGCCAAGAATATAATGTCCGAGTCTCGAGACTCGGACATTATATTCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177559.x-738s1c1
Sequence:CCGGCGTAAACAACACAGACTTCAACTCGAGTTGAAGTCTGTGTTGTTTACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177559.2-1020s1c1
Sequence:CCGGCGATTATAGTTTGGATATGTGCTCGAGCACATATCCAAACTATAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177559.2-894s21c1
Sequence:GTACCGGGCACAGAAAGCTACGACTAATCTCGAGATTAGTCGTAGCTTTCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177559.2-1295s21c1
Sequence:GTACCGGTGGACAAACTGCTGCGATATGCTCGAGCATATCGCAGCAGTTTGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_177559.2-1813s21c1
Sequence:CCGGTGGAATATTTCATGGACAAATCTCGAGATTTGTCCATGAAATATTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_177559.2-1895s21c1
Sequence:CCGGCAATCCCGGCTGCTGCATTTACTCGAGTAAATGCAGCAGCCGGGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_177559.2-1801s21c1
Sequence:CCGGATTACCTGCAGGTGGAATATTCTCGAGAATATTCCACCTGCAGGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177559.2-1906s21c1
Sequence:CCGGGCTGCATTTAGGTGGAGACTTCTCGAGAAGTCTCCACCTAAATGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177559.2-738s21c1
Sequence:CCGGCGTAAACAACACAGACTTCAACTCGAGTTGAAGTCTGTGTTGTTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177559
VALIDATED
CSNK2A1 MISSION shRNA shRNA Plasmid DNA
casein kinase 2, alpha 1 polypeptide
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177559.x-650s1c1
Sequence:CCGGAGAATTTGAGAGGAGGTCCCACTCGAGTGGGACCTCCTCTCAAATTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177559.x-949s1c1
Sequence:CCGGCAAGAATATAATGTCCGAGTTCTCGAGAACTCGGACATTATATTCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001986    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177559.x-1906s1c1
Sequence:CCGGGCTGCATTTAGGTGGAGACTTCTCGAGAAGTCTCCACCTAAATGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177559.x-948s1c1
Sequence:CCGGCCAAGAATATAATGTCCGAGTCTCGAGACTCGGACATTATATTCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177559.x-738s1c1
Sequence:CCGGCGTAAACAACACAGACTTCAACTCGAGTTGAAGTCTGTGTTGTTTACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177559.2-1020s1c1
Sequence:CCGGCGATTATAGTTTGGATATGTGCTCGAGCACATATCCAAACTATAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177559.2-894s21c1
Sequence:GTACCGGGCACAGAAAGCTACGACTAATCTCGAGATTAGTCGTAGCTTTCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177559.2-1295s21c1
Sequence:GTACCGGTGGACAAACTGCTGCGATATGCTCGAGCATATCGCAGCAGTTTGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_177559.2-1813s21c1
Sequence:CCGGTGGAATATTTCATGGACAAATCTCGAGATTTGTCCATGAAATATTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_177559.2-1895s21c1
Sequence:CCGGCAATCCCGGCTGCTGCATTTACTCGAGTAAATGCAGCAGCCGGGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_177559.2-1801s21c1
Sequence:CCGGATTACCTGCAGGTGGAATATTCTCGAGAATATTCCACCTGCAGGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177559.2-1906s21c1
Sequence:CCGGGCTGCATTTAGGTGGAGACTTCTCGAGAAGTCTCCACCTAAATGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177559.2-738s21c1
Sequence:CCGGCGTAAACAACACAGACTTCAACTCGAGTTGAAGTCTGTGTTGTTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177559
VALIDATED
CSNK2A1 MISSION shRNA Lentiviral Transduction Particles
casein kinase 2, alpha 1 polypeptide
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177559.x-650s1c1
Sequence:CCGGAGAATTTGAGAGGAGGTCCCACTCGAGTGGGACCTCCTCTCAAATTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177559.x-949s1c1
Sequence:CCGGCAAGAATATAATGTCCGAGTTCTCGAGAACTCGGACATTATATTCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001986    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177559.x-1906s1c1
Sequence:CCGGGCTGCATTTAGGTGGAGACTTCTCGAGAAGTCTCCACCTAAATGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177559.x-948s1c1
Sequence:CCGGCCAAGAATATAATGTCCGAGTCTCGAGACTCGGACATTATATTCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177559.x-738s1c1
Sequence:CCGGCGTAAACAACACAGACTTCAACTCGAGTTGAAGTCTGTGTTGTTTACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177559.2-1020s1c1
Sequence:CCGGCGATTATAGTTTGGATATGTGCTCGAGCACATATCCAAACTATAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177559.2-894s21c1
Sequence:GTACCGGGCACAGAAAGCTACGACTAATCTCGAGATTAGTCGTAGCTTTCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177559.2-1295s21c1
Sequence:GTACCGGTGGACAAACTGCTGCGATATGCTCGAGCATATCGCAGCAGTTTGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_177559.2-1813s21c1
Sequence:CCGGTGGAATATTTCATGGACAAATCTCGAGATTTGTCCATGAAATATTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_177559.2-1895s21c1
Sequence:CCGGCAATCCCGGCTGCTGCATTTACTCGAGTAAATGCAGCAGCCGGGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_177559.2-1801s21c1
Sequence:CCGGATTACCTGCAGGTGGAATATTCTCGAGAATATTCCACCTGCAGGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177559.2-1906s21c1
Sequence:CCGGGCTGCATTTAGGTGGAGACTTCTCGAGAAGTCTCCACCTAAATGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177559.2-738s21c1
Sequence:CCGGCGTAAACAACACAGACTTCAACTCGAGTTGAAGTCTGTGTTGTTTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001895
CSNK2A1 MISSION shRNA Bacterial Glycerol Stock
casein kinase 2, alpha 1 polypeptide
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000606    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001895.x-1789s1c1
Sequence:CCGGGCTGCATTTAGGTGGAGACTTCTCGAGAAGTCTCCACCTAAATGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001895.x-832s1c1
Sequence:CCGGCAAGAATATAATGTCCGAGTTCTCGAGAACTCGGACATTATATTCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001895.x-831s1c1
Sequence:CCGGCCAAGAATATAATGTCCGAGTCTCGAGACTCGGACATTATATTCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001895.x-533s1c1
Sequence:CCGGAGAATTTGAGAGGAGGTCCCACTCGAGTGGGACCTCCTCTCAAATTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001895.x-621s1c1
Sequence:CCGGCGTAAACAACACAGACTTCAACTCGAGTTGAAGTCTGTGTTGTTTACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001895
CSNK2A1 MISSION shRNA shRNA Plasmid DNA
casein kinase 2, alpha 1 polypeptide
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000606    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001895.x-1789s1c1
Sequence:CCGGGCTGCATTTAGGTGGAGACTTCTCGAGAAGTCTCCACCTAAATGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001895.x-832s1c1
Sequence:CCGGCAAGAATATAATGTCCGAGTTCTCGAGAACTCGGACATTATATTCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001895.x-831s1c1
Sequence:CCGGCCAAGAATATAATGTCCGAGTCTCGAGACTCGGACATTATATTCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001895.x-533s1c1
Sequence:CCGGAGAATTTGAGAGGAGGTCCCACTCGAGTGGGACCTCCTCTCAAATTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001895.x-621s1c1
Sequence:CCGGCGTAAACAACACAGACTTCAACTCGAGTTGAAGTCTGTGTTGTTTACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001895
CSNK2A1 MISSION shRNA Lentiviral Transduction Particles
casein kinase 2, alpha 1 polypeptide
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000606    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001895.x-1789s1c1
Sequence:CCGGGCTGCATTTAGGTGGAGACTTCTCGAGAAGTCTCCACCTAAATGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001895.x-832s1c1
Sequence:CCGGCAAGAATATAATGTCCGAGTTCTCGAGAACTCGGACATTATATTCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001895.x-831s1c1
Sequence:CCGGCCAAGAATATAATGTCCGAGTCTCGAGACTCGGACATTATATTCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001895.x-533s1c1
Sequence:CCGGAGAATTTGAGAGGAGGTCCCACTCGAGTGGGACCTCCTCTCAAATTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001895.x-621s1c1
Sequence:CCGGCGTAAACAACACAGACTTCAACTCGAGTTGAAGTCTGTGTTGTTTACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007788
VALIDATED
CSNK2A1 MISSION shRNA Bacterial Glycerol Stock
casein kinase 2, alpha 1 polypeptide
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007788.2-1210s1c1
Sequence:CCGGGCCAATATGATGTCAGGGATTCTCGAGAATCCCTGACATCATATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007788.2-1066s1c1
Sequence:CCGGCTGGACAAGCTGCTTCGATATCTCGAGATATCGAAGCAGCTTGTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007788.2-735s1c1
Sequence:CCGGCCGAGTTGCTTCTCGATATTTCTCGAGAAATATCGAGAAGCAACTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007788.2-550s1c1
Sequence:CCGGACAGACTATGACATTCGATTTCTCGAGAAATCGAATGTCATAGTCTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007788.2-516s1c1
Sequence:CCGGCAACACAGACTTCAAGCAATTCTCGAGAATTGCTTGAAGTCTGTGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007788.3-627s21c1
Sequence:CCGGGCAATTGTACCAGACGTTAACCTCGAGGTTAACGTCTGGTACAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007788.3-1293s21c1
Sequence:CCGGACCTGTCAGCAGCGCCAATATCTCGAGATATTGGCGCTGCTGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007788.3-830s21c1
Sequence:CCGGTCCGAGTTGCTTCTCGATATTCTCGAGAATATCGAGAAGCAACTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007788
VALIDATED
CSNK2A1 MISSION shRNA shRNA Plasmid DNA
casein kinase 2, alpha 1 polypeptide
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007788.2-1210s1c1
Sequence:CCGGGCCAATATGATGTCAGGGATTCTCGAGAATCCCTGACATCATATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007788.2-1066s1c1
Sequence:CCGGCTGGACAAGCTGCTTCGATATCTCGAGATATCGAAGCAGCTTGTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007788.2-735s1c1
Sequence:CCGGCCGAGTTGCTTCTCGATATTTCTCGAGAAATATCGAGAAGCAACTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007788.2-550s1c1
Sequence:CCGGACAGACTATGACATTCGATTTCTCGAGAAATCGAATGTCATAGTCTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007788.2-516s1c1
Sequence:CCGGCAACACAGACTTCAAGCAATTCTCGAGAATTGCTTGAAGTCTGTGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007788.3-627s21c1
Sequence:CCGGGCAATTGTACCAGACGTTAACCTCGAGGTTAACGTCTGGTACAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007788.3-1293s21c1
Sequence:CCGGACCTGTCAGCAGCGCCAATATCTCGAGATATTGGCGCTGCTGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007788.3-830s21c1
Sequence:CCGGTCCGAGTTGCTTCTCGATATTCTCGAGAATATCGAGAAGCAACTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007788
VALIDATED
CSNK2A1 MISSION shRNA Lentiviral Transduction Particles
casein kinase 2, alpha 1 polypeptide
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007788.2-1210s1c1
Sequence:CCGGGCCAATATGATGTCAGGGATTCTCGAGAATCCCTGACATCATATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007788.2-1066s1c1
Sequence:CCGGCTGGACAAGCTGCTTCGATATCTCGAGATATCGAAGCAGCTTGTCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007788.2-735s1c1
Sequence:CCGGCCGAGTTGCTTCTCGATATTTCTCGAGAAATATCGAGAAGCAACTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007788.2-550s1c1
Sequence:CCGGACAGACTATGACATTCGATTTCTCGAGAAATCGAATGTCATAGTCTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007788.2-516s1c1
Sequence:CCGGCAACACAGACTTCAAGCAATTCTCGAGAATTGCTTGAAGTCTGTGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007788.3-627s21c1
Sequence:CCGGGCAATTGTACCAGACGTTAACCTCGAGGTTAACGTCTGGTACAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007788.3-1293s21c1
Sequence:CCGGACCTGTCAGCAGCGCCAATATCTCGAGATATTGGCGCTGCTGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007788.3-830s21c1
Sequence:CCGGTCCGAGTTGCTTCTCGATATTCTCGAGAATATCGAGAAGCAACTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)